Skip to main content
Download PDF

Phage vB_Ec_ZCEC14 to treat antibiotic-resistant Escherichia coli isolated from urinary tract infections

Virology Journal volume 21, Article number: 44 (2024) Cite this article

Abstract

Escherichia coli is a commensal bacterial species in the human gastrointestinal tract; however, it could be pathogenic and cause severe infections in intra and extra-intestinal sites. Uropathogenic E. coli accounts for 80–90% of urinary tract infections that can result in urosepsis and septic shock. Consequently, multidrug-resistant uropathogenic E. coli poses a considerable risk to the healthcare system worldwide. Phage therapy is demonstrated as an optimistic solution to over-the-counter antibiotics that contribute to the global issue of multidrug-resistant bacteria. This study aims to isolate a novel phage that could be implemented to cure urinary tract infections mediated by multidrug-resistant E. coli. Twenty-seven E. coli isolates were collected from patients with urinary tract infections to assess the antibacterial efficacy of phage vB_Ec_ZCEC14. Phage kinetics were encountered against the E. coli strain (EC/4), in addition to evaluating phage stability under various temperatures, pH values, and UV exposure periods. Full genome sequencing and morphological analysis were conducted for further phage characterization, which revealed that phage vB_Ec_ZCEC14 belongs to the family Straboviridae. Phage vB_Ec_ZCEC14 showed thermal tolerance at 80 ℃, pH stability between pH 3 and pH 12, and endurance to UV exposure for 45 min. The phage-host interaction results revealed that phage vB_Ec_ZCEC14 has strong and steady antibacterial action at lower concentrations (MOI 0.1). The study findings strongly indicate that phage vB_Ec_ZCEC14 holds significant promise as a potential therapeutic alternative for treatment of antibiotic-resistant uropathogenic E. coli.

Introduction

Urinary tract infections (UTIs) are quite common these days due to many bacterial infections. Urinary tract infections (UTIs) are a major cause of disease worldwide, accounting for 404.6 million cases in both males and females each year and 236,786 fatalities [1]. It accounts for 13–19% of cases and poses a considerable risk of developing urosepsis, which occurs in up to 25% of patients [2]. Some urinary tract infections damage the urethra and bladder. Upper urinary tract infections can be fatal if bacteria from the infected kidneys enter the bloodstream, a condition known as urosepsis [3]. Urinary tract stones could be peripheral to UTIs, as uropathogens can promote stone origination. Patients with urolithiasis, who are suffering from UTIs, are more likely to encounter severe complications following surgical operations, such as systemic inflammation, postoperative infection, and death due to septic shock [4, 5].

While Gram-negative bacilli cause most of the urosepsis incidents, E. coli accounts for 50% of the cases, followed by Enterobacter spp. and Klebsiella spp. (15%), Proteus spp. (15%), and Pseudomonas aeruginosa (5%). Whereas Gram-positive bacteria only comprise about 15% of the cases [6]. E. coli is predominant in the large intestine of warm-blooded mammals and results in widespread bacterial infections in humans and livestock [7]. E. coli strains may be commensal, residing in a symbiotic relationship that confers resistance to harmful species, or they could be pathogenic and cause severe infections of intestinal and extraintestinal locations [8]. E. coli is responsible for up to 90% of UTI incidences and is often detected in the gastrointestinal microbiota of the same host [9, 10].

Extraintestinal pathogenic E. coli (ExPEC) bacteria are categorized into uropathogenic E. coli (UPEC), neonatal meningitis E. coli, and septicemic E. coli [11]. E. coli causes UTIs both in the general public and in hospitals, particularly originated by biofilm-producing E. coli and extended-spectrum beta-lactamase E. coli (ESBL) [12, 13]. UPEC is the most prevalent E. coli type of ExPEC among UTIs patients [14]. Oral antibiotics e.g. fluoroquinolones, rimethoprim-sulfamethoxazole and cephalosporins have been traditionally used to treat UTIs resulted by E. coli [15]. Unfortunately, these drugs’ effectiveness has decreased recently due to widespread usage and the emergence of resistance [16].

Antibiotic-resistant bacteria have become an alarming public health concern in the last few decades [17]. Finding alternatives to treat bacterial infections has become a key research priority because of the increasing prevalence of Multi-Drug-Resistant (MDR) bacterial infections, particularly in hospitals. In addition to standard antibiotics, innovative treatment techniques must be established quickly [18, 19] The imminent deterioration of current antibiotics has rekindled a global interest in phage therapy [20]. Alternatively, phage therapy is considered as a potential therapeutic solution that may reduce the growing antibiotic resistance, either as a substitute for antibiotics or in conjunction with antibiotic treatment [21]. Bacteriophage therapy was reported to be a safe, competent, and simple substitute to deal with the outgrowing issues accompanying MDR bacteriaIn clinical research conducted in the late 1950s, 607 individuals who had not responded to conventional antibiotic therapy were treated with bacteriophages, and no adverse consequences were noted [21, 22]. Prof. Stefan Slopek, who had a pioneering role in bacteriophage research in Poland, claimed that adverse outcomes due to phage therapy were rarely seen among 550 cases screened at the Hirszfeld Institute between 1981 and 1986. In addition, more than one thousand patients were treated with bacteriophage between 1954 and 1987, and their cases reported a success rate of 84–97% [23, 24].

. Phages lyse their host bacterial cells without affecting the non-host species. Following the elimination of the bacterial host, the count of the phage population reduces as well, maintaining the microbiota’s stability and variety [25].

In this study, we isolated a new phage vB_Ec_ZCEC14, to inhibit the multidrug-resistant UPEC EC/04. The results of our study showed vB_Ec_ZCEC14 ability to lyse MDR E. coli isolated from UTIs. This is a step towards identifying an alternative therapy for multi-drug resistant UPECs.

Materials & methods

Bacterial isolation

Thirty-two UTIs E. coli isolates were collected from different human urine samples at Suez Canal University Hospital and gifted to Center for Microbiology and Phage Therapy at Zewail City of Science and Technology. In addition, ten E. coli strains from E. coli reference (ECOR) collection were used in this study. Bacterial isolates were identified and confirmed through culturing on differential selective Eosin Methylene Blue media (EMB-Oxoid, UK) and MacConkey agar (Oxoid, UK) prior to additional subcultures. Furthermore, the bacterial identity was validated and confirmed by PCR, in which QIAamp DNA Mini kit (Qiagen, Germany) was used for DNA extraction from bacterial isolates. Furthermore, size of the PCR product was determined by running it on an agarose gel (1.0% (w/v) agarose). Tryptone Soy Agar (TSB-Merck, Germany) was used in all study experiments. Tryptone Soy Broth (Merck, Germany) supplemented with 20–25% (w/v) glycerol was used to preserve all isolates at -80 Â°C until they were needed.

16 S ribosomal RNA gene sequencing

E. coli isolate (EC/4) was identified through PCR amplification using the primers F (5′- AAGAAGCACCGGCTAACTCC − 3′) - R (5′- CGCTTCTCTTTGTATGCGCC − 3′) and 16 S rRNA gene sequencing using 27 F and 1492R primers. 16 S rRNA sequencing was conducted using the automated fluorescent-DNA sequencer (Applied Biosystem, model 373/USA). Finch TV (digitalworldbiology.com/FinchTV/; date of access: 11-AUG-2022) was used to check quality and clean the sequence. BLASTn (Altschul et al., 1990) was used to check the homology in the bacterial 16 S rRNA database (Access date: Aug 11, 2022). The sequenced 16 S rRNA gene of EC/4 has been deposited into the NCBI GenBank database (Accession Number OP205141).

Detection of resistance and virulence genes by PCR

Antibiotic resistance and virulence genes were screened in the tested E. coli isolates. They were cultured for 4 h in Tryptone Soy Broth (TSB-Merck, Germany). PCR amplification was then conducted to detect the following virulence genes: fimH, traT, blaTEM, blaSHV, blaCTX, and tetA. All the primer sequences, annealing temperatures, and amplicon sizes are provided in Table 1.

Table 1 Conditions and primers for PCR amplification of species, antibiotic resistance genes, and virulence markers in E. coli isolates
Full size table

Antibiotic susceptibility assay

Antibiotic susceptibility of E. coli isolates was tested following National Committee for Clinical Laboratory Standards (NCCLS) guidelines using disc diffusion method [32]. Among the 32 urine isolates, only 25 of them were confirmed as E. coli and they were subjected to a panel of antibiotic discs including: Amoxicillin (AMC; 30 Î¼g), Ceftriaxone (CRO; 30 Î¼g), Chloramphenicol (C; 30 Î¼g), Ciprofloxacin (CIP; 5 Î¼g), Doxycycline (DO; 30 Î¼g), Etrapenem (ETP; 10 Î¼g), Gentamicin (CN; 10 Î¼g), Nalidixic acid (NA; 30 Î¼g), Nitrofurantoin (F; 300 Î¼g), Norfloxacin (NOR; 10 Î¼g), and Tetracycline (TE; 10 Î¼g). Then, the diameter of inhibition zone for each antibiotic was measured and interpreted [33, 34] in reference to the Clinical and Laboratory Standards Institute [35]. Accordingly, E. coli isolates were classified into resistant, intermediate resistant, or susceptible.

Bacteriophage isolation and amplification

Twenty sewage-water samples were collected from Giza area, Egypt to isolate bacteriophages. Sewage water samples were pre-incubated overnight with a cocktail of confirmed E. coli isolates to enrich the phage population [36]. The samples were centrifuged at 4 ℃ for 15 min at 5000 rpm [37, 38] and chloroform (1%) was added to lyse bacterial cells having intracellular phages. To examine the lysis efficacy of the isolated phages to bacterial hosts, spot assay was conducted on a fresh lawn of bacterial isolates on a soft-overlay agar [39, 40]. Seven clear-plaquing phages against different bacterial hosts were subjected to further investigations using the primary bacterial host EC/4. Phage purification was performed through four to five isolations of each single plaque. All phage amplifications were conducted in liquid culture of tryptic soya, followed by cooling centrifugation at 5000 rpm for 15 min and the supernatant lysate was collected [41, 42]. Next, the phage count was enumerated by performing a 10-fold serial dilution and spotting 10 μL volume of each dilution in triplicate on a fresh lawn of the bacterial host [43]. The purified phages were stored in SM buffer (pH 7.5) [44]. Phage vB_Ec_ZCEC14 was selected among all the isolated phages according to its broad host range.

Phage host range analysis

Host range analysis of phage vB_Ec_ZCEC14 was performed using the twenty-five confirmed E. coli isolates and ten isolates from ECOR collection. A spot assay was conducted by adding 100 μL volume of a mid-log growing bacterial culture to 4 mL volume of soft agar (0.3% w/v), followed by pouring the mixture onto the top of TSA agar base [45]. Finally, the phage lysate was spotted with volume 10 μL in triplicates on the dried bacterial lawns that were overnight incubated at 37 Â°C [46].

Efficiency of plating (EOP)

Efficacy of phage vB_Ec_ZCEC14 against susceptible E. coli host strains was carried out as a further assessment. This experiment is conducted using log-phase bacteria under the same conditions of the spotting assay. After an overnight incubation period, the PFUs formed by the phage on each bacterial host were counted and the average was calculated and then divided by the highest observed PFU count to get the EOP [47, 48].

Frequency of bacteriophage insensitive mutants (BIMs)

To determine the BIMs, the susceptible bacterial host EC/4 was treated with phage vB_Ec_ZCEC14 at multiplicity of infection (MOI) concentration 100. The phage suspension was serially diluted and spotted after 10 min of incubation at 37 Â°C as described before, followed by an overnight incubation. The BIM is calculated as the ratio of viable bacterial counts that resist phage infection to the primary viable bacterial counts [49].

Pulsed field gel electrophoresis (PFGE)

DNA of phage vB_Ec_ZCEC14 (\( {10}^{10}\) PFU/mL) was prepared for PFGE to determine the genome size [50, 51]. In brief, phage capsids and protein were subjected to digestion overnight at 55 Â°C in lysis buffer (1 mg/mL proteinase K; 100 mM EDTA; 0.2% w/v SDS; 1% w/v N-lauryl sarcosine) with gentle shaking. Agarose-containing DNA slices were washed in washing buffer and placed into wells of a 1% w/v agarose gel. Then, electrophoresis was performed using running buffer (0.5 Tris-borate-EDTA) in a Bio-Rad CHEF DRII system at 200 V (6 V/cm) at 14 Â°C for 18 h with 30 to 60 s switch time. Lambda DNA markers (Sigma Aldrich, Gillingham, UK) were used to determine the genome size of phage vB_Ec_ZCEC14.

Bacteriophage morphology

The morphological structure of phage vB_Ec_ZCEC14 was examined using Transmission Electron Microscopy (TEM) at the Medical Research Institute (Alexandria, Egypt). A high concentration of purified phage vB_Ec_ZCEC14 lysate (1010 PFU/ml) was loaded into copper grids coated with a Formvar carbon before treatment of grids with 2.5% glutaraldehyde, followed by rinsing and staining with 2% phosphotungstic acid at pH 7.0. After drying, copper grids were examined by TEM (JEOL 1230) to obtain micrographs of phage vB_Ec_ZCEC14 [52].

In vitro characterization of phage vB_Ec_ZCEC14

Lytic activity of vB_Ec_ZCEC14 against bacterial host strain EC/4 was in vitro examined at MOI values: 0.1, 1, and 10 PFU/CFU. It was evaluated against log-phase growing E. coli EC/4 (108 CFU/mL) at 37 Â°C over ten time intervals (0, 10, 20, 30, 40, 60, 75, 90, 120, and 180 min) [53]. In summary, two flasks were prepared, one as a control containing bacterial culture without phage and the other containing the same culture supplemented with bacteriophage at the same MOI. Simultaneously, titers of bacterial control (B), bacterial survival (BS), and plaque-forming units (PFU) were calculated at all time points. Samples of B and BS were subjected to concentration calculations following Miles and Misra method [54]. Briefly, serial dilutions were prepared after mixing 100 Î¼l of the sample with 900 Î¼l TSB. The contents were gently shaken to achieve a consistent distribution of cells and get the required dilution (10− n). A 10 Î¼l of each dilution is spotted on a bacterial lawn of the host strain. The agar plates were incubated for 18 to 24 h at 35 to 37 Â°C. Meanwhile, double-agar overlay plaque assay was implemented to determine PFU titer as described before.

Bacteriophage pH, temperature, and UV stability

The thermal stability of vB_Ec_ZCEC14 (at a concentration of \( {10}^{9}\) PFU/ml) was measured over a period of one hour, using a water bath. The tested temperatures included 4 Â°C, 20 Â°C, 37 Â°C, 50 Â°C, 60 Â°C, 70 Â°C, 75 Â°C, and 80 Â°C [55]. Following the standard double layer technique, serial dilutions of phage vB_Ec_ZCEC14 were in triplicate applied on bacterial lawns of host strain EC/4 immediately after incubation, in order to ascertain the phage’s titers [56]. The assessment of the phage’s UV stability was conducted at discrete time points of 15, 30, 45, and 60 min under the UV lamb of the biological safety cabinet with intensity around 253.7 nm. The standard double-layer technique was used to enumerate phage titers. Stability of pH was determined through incubation for 24 h at different pH values (1, 2, 4, 5, 7, 9, 10, 12, and 13) [57].

DNA sequencing and bioinformatic analysis for phage vB_Ec_ZCEC14

The genomic DNA was extracted using the following platform. First, vB_Ec_ZCEC14 (≈ 10¹° PFU/mL) lysates were incubated with proteinase K solution (100 g/mL dissolved in 10 mM EDTA (pH = 8)). Afterwards, the genomic DNA was extracted using DNA Wizard Kit (Promega, United Kingdom). Illumina MiSeq sequencing was conducted following Nextera tagmentation (Illumina, Cambridge, UK) workflow, generating 150 bp paired end reads. FASTQC [58] was used to check sequencing quality and poor-quality bases were cleaned using PRINSEQ [59]. SPAdes [60] assembler was integrated for de novo assembly of the cleaned data using different K-mers, generating one unique contigs of 165,622 bp length. Quality of de novo assembly was statistically measured using QUAST [61]. ORF finder (Access date: 10 June 2022; available at: www.ncbi.nlm.nih.gov/orffinder/) was implemented to predict open-reading frames. Coding sequences (CDSs) were manually curated through BLASTp [62] of the resulted ORFs against NCBI Protein database (NR). Functional annotation of CDSs was also compared to PATRIC [63] and RASTtk [64] platforms to increase our confidence in the predicted function of coding regions. Genetic maps were generated using SNAPGene highlighting coding genes of assigned functions (GSL Biotech; access date: 11 June 2022; Available at: www.snapgene.com/). The vB_Ec_ZCEC14 genome has been imported into GenBank under the entry number OP168898. PhageLeads explored the presence of any temperate, virulence, and antibiotic resistance genes to check phage suitability for therapeutic applications [65]. In addition, DeepTMHMM was used to detect transmembrane topology among the predicted proteins. Transmembrane proteins play a crucial role in viral pathogenicity and different stages of replication, starting from genome uncoating ending up with viral release [66]. Phylogeny of phage vB_Ec_ZCEC14 was screened using multiple platforms. Highly similar phages to phage vB_Ec_ZCEC14 were characterized by BLASTn [62]. The genome-genome distances were computed using VICTOR phylogeny [67] using the BLASTn top 100 matched phages. Pairwise sequence alignments were performed following Genome-BLAST Distance Phylogeny (GBDP) workflow [68]. In addition, intergenomic pairwise similarities were calculated following VIRDIC workflow [69], in which species (> 95%) and genus (> 70%) thresholds were used as default parameters. Furthermore, Viral Proteomic Tree (ViPTree) [70] was implemented to draw a proteomic tree of vB_Ec_ZCEC14 following tBLASTx (Altschul et al. 1990) genome-wide sequence alignments. Orthologous (signature) genes between vB_Ec_ZCEC14 and closely related phages generated from ViPTree were predicted by CoreGenes 0.5 [71]. Conserved proteins were used to draw a phylogenetic tree in MEGA 11 [72] using top BLASTp matched of other phages. CLUSTAL-W aligner was used to compare the conserved proteins [72] and bootstrap of 1000 replicates and best Maximum Likelihood fit model were the default settings.

Results

Bacterial isolation and identification

PCR results validated the identity of E. coli isolates using the specific primers (F: 5′- AAGAAGCACCGGCTAACTCC − 3′ and R: 5′- CGCTTCTCTTTGTATGCGCC − 3′) by amplification of a 766-bp band matching a conserved area in 16 S rRNA. E. coli strain EC/4 was partially sequenced and deposited into GenBank (Acc. No. OP205141). BLASTn results of EC/4 sequence showed 98.54% sequence identity to E. coli NBRC 102,203 strain.

Virulence genes

A survey of six pathogenicity genes of E. coli (traT, fimH, blaCTX, blaSHV, blaTEM, and tetA) was tested in eight highly MDR isolates using a PCR assay. The results revealed that two isolates have five out of six genes, three isolates have four genes, one isolate has three genes, and the remaining two isolates have two genes.

Antibiotic susceptibility profile

The sensitivity of bacterial isolates to antibiotics is classified into three categories: susceptible, intermediate resistant, and resistant. Antibiotic susceptibility test of E. coli isolates reflected their different sensitivity patterns to the tested antibiotic classes. The results revealed that 8 confirmed E. coli isolates are MDR bacteria based on their MAR index as they showed resistance to 5 or 6 classes of antibiotics, as illustrated in Table 2. Three isolates were resistant to Nitrofurantoin (F) and Amoxicillin (AMC); 12 resistant to Tetracycline (TE) and Nalidixic acid (NA); 2 resistant to Chloramphenicol (C); 5 resistant to Ertapenem (ETP); 9 resistant to Norfloxacin (NOR); 10 resistant to Gentamicin (CN); 11 resistant to Doxycycline (DO); and finally 15 resistant to Ceftriaxone (CRO).

Table 2 Antibiotic susceptibility of E. coli isolates. Abbreviations: MAR: Multi-drug resistant, S: Sensitive, I: Intermediate, R: Resistant, C: Chloramphenicol, CRO: Ceftriaxone, DO: Doxycycline, NOR: Norfloxacin, AMC: Amoxicillin, TE: Tetracycline, CIP: Ciprofloxacin, ETP: Etrapenem, F: Nitrofurantoin, NA: Nalidixic acid and CN: Gentamicin
Full size table

Morphology of phage vB_Ec_ZCEC14

The TEM images of phage vB_Ec_ZCEC14 indicated that phage vB_Ec_ZCEC14 exhibits an icosahedral head (∼130 nm diameter) and a contractile tail (∼120 nm) with a base plate, as depicted in Fig. 1.

Fig. 1
figure 1

Morphology of phage vB_Ec_ZCEC14 by Transmission electron microscope

Full size image

Host range and efficiency of plating (EOP)

Phage host range was investigated against 25 E. coli isolates recovered from urine clinical samples and 10 E. coli isolates from the ECOR collection. It was able to produce lysis zones (≥ 20 plaques) against 11 out of 25 E. coli isolates and to E. coli O25 out of the 10 ECOR strains, which reflects broad range infectivity. Various strains of E. coli were found to exhibit a range of EOP when exposed to phage vB_Ec_ZCEC14. Among the eleven isolates of E. coli that were susceptible, it was observed that three of them exhibited an EOP value ≥ 1, while the remaining eight isolates demonstrated an EOP value < 1.

Frequency of BIMs

The BIMs were measured to determine the long-term lysis efficiency of phage vB_Ec_ZCEC14. The BIMs were retrieved subsequent to a high multiplicity infection of 100 in the host E. coli strain EC/4 with phage vB_Ec_ZCEC14 at 37 Â°C. The BIM frequencies were determined to be 0.0043 ± 0.0022.

In vitro investigation of phage vB_Ec_ZCEC14

The dynamics and characteristics of the bacteriolytic activity of phage vB_Ec_ZCEC14’s was investigated against the host bacteria EC/4 at different MOIs (0.1, 1, and 10) over a period of 3 h (Fig. 2A and C). The bacteriolytic efficacy of phage vB_Ec_ZCEC14 was assessed through a comparative analysis of the growth reduction of the host EC/4 treated with phage, compared to the bacterial control without phage. The viable bacterial count was initially 6.7 log10 CFU/mL at MOI 10 and 7.5 log10 CFU/mL at MOI 0.1. Phage vB_Ec_ZCEC14 took 60 min to make a significant decrease in viable bacterial count to ∼3 log10 CFU/mL at both MOI 10 (P < 0.0002) and MOI 0.1 (P < 0.0007), as shown in Fig. 2A, C. While it took 90 min to reduce the viable bacterial count from 6.7 log10 CFU/mL to ∼3 log10 CFU/mL at MOI 1 (P < 0.0006), as shown in Fig. 2B. A slight recovery of bacterial populations was observed after 120 min; however, it did not reach a one-log increase in the viable bacterial count at the end. A decrease in viable bacterial count was accompanied by an observable increase in phage titers at MOI 1 to 9 log10 and MOI 0.1 to 8 log10 (Fig. 2A, B), while it did not encounter significant measurable change at MOI 10 (Fig. 2C). At lower MOIs, phage replication was observed, coinciding with the initial decline in viable bacterial count. Based on the above results, phage vB_Ec_ZCEC14 showed potent bacteriolytic activity at different MOIs.

Fig. 2
figure 2

These figures illustrate the in vitro data of vB_Ec_ZCEC14 at 37 Â°C. They represent the bacterial and phage titers of EC/4 infected with vB_Ec_ZCEC14 at (A) MOI 0.1, (B) MOI 1, and (C) MOI 10. MOI: Multiplicity of infection; BS: Bacterial Survival

Full size image

Phage vB_Ec_ZCEC14 temperature, UV, and pH stability

Evaluation of phage endurance at broad range of temperatures, exposure periods to UV, and pH is an essential assessment for its applicability as a biocontrol agent. Accordingly, the stability of vB_Ec_ZCEC14 was evaluated at various temperatures, pH values and UV conditions. Compared to the initial phage titer (108 PFU/ml), phage vB_Ec_ZCEC14 was stable with its initial titer (108 PFU/ml) for 60 min at the following temperatures − 20, 4, 37, 50, and 60 Â°C. Higher temperatures 75 ℃ and 80 ℃significantly dropped phage titers to 106 PFU/mL and 104 PFU/ml, respectively, which proves the endurance of phage vB_Ec_ZCEC14 to high temperatures, as shown in Fig. 3A. The stability of phage vB_Ec_ZCEC14 was evaluated by subjecting it to varying pH levels. It exhibits optimal stability over a pH range of 7.0 to 11.0, thereby retaining its initial titer of 108 PFU/ml. At acidic pH values (pH 3.0 to pH 6.0), phage titers encountered a one-log reduction, while at pH 12.0, phage titer significantly dropped to 105 PFU/ml. Phage vB_Ec_ZCEC14 was observed to be rendered entirely inactive upon being subjected to pH 3.0 and pH 13.0, and titers declined below detection limit, as shown in Fig. 3B. The stability of phage vB_Ec_ZCEC14 (108 PFU/ml) was evaluated over different time periods of UV exposure 15, 30, 45, and 60 min. Phage titer decreased after 15 min of exposure to UV to 106 PFU/ml. The results depicted in Fig. 3C indicated that phage titer is reduced to 104 PFU/mL after 30 min and even for 45 min. The phage was inactive after 60 min of exposure to UV and its titer was below the limit of detection, as illustrated in Fig. 3C.

Fig. 3
figure 3

Phage vB_Ec_ZCEC14 viability at different ranges of temperature (A), pH (B), and UV exposure (C). PFU: Plaque forming unit

Full size image

DNA sequencing, assembly, and annotation for phage vB_Ec_ZCEC14

In consistence with the PFGE results, DNA sequencing of vB_Ec_ZCEC14 genome revealed a double-stranded DNA of ∼166 kbp length. Then, the phage genome was submitted into GenBank (Acc. No. OP168898). Genome assembly showed the following metrics: contigs no. 1; GC% 48.87; N50 165,622; L50 1; and 0 N’s per 100 kb. Two hundred and sixty-five protein-coding genes were predicted through integration of different annotation platforms, among which one hundred and forty-seven proteins have allocated functions linked to DNA replication transcription/packaging/repair, cell lysis, and structural phage proteins (Supplementary Table S1). Furthermore, phage vB_Ec_ZCEC14 did not encode any lysogenic genes such as integrase or transposases. On the plus strand, phage vB_Ec_ZCEC14 has two hundred and twenty-three ORFs, while it has only forty-two ORFs on the complementary strand. Further genetic details are illustrated on the genetic map which highlight functional genes as shown in Fig. 4. Genomic analysis uncovered two repeat regions and ten tRNA (Arg, Asn, Gln, Gly, Leu, Met, Pro, Ser, Thr, and Tyr). PhageLeads screened the genome without detection of any genes with the potential of antibiotic resistance, lysogenic lifecycle, or bacterial virulence. This indicates the applicability of vB_Ec_ZCEC14 in therapeutic purposes. Regarding transmembrane domains, they were detected in thirteen proteins using DeepTMHMM. Three TMDs was only predicted in immunity protein (ORF 212) (Fig. 5). While two TMDs were recorded in seven proteins (ORFs: 117, 126, 161, 168, 184, 213, and 226), and one TMD was recorded in five proteins (ORFs: 11, 65,103, 259, and 260).

Fig. 4
figure 4

Genetic map of vB_Ec_ZCEC14 highlighting coding sequences with assigned function. Some functional genes were not illustrated due to space limits

Full size image
Fig. 5
figure 5

Transmembrane topology in immunity protein (ORF 212). X-axis: sequence position of amino acids; Y-axis: prediction probability; Red blocks: transmembrane domains; Blue line: domains outside the membrane; Pink line: domains inside the membrane

Full size image

Phylogenetic analysis of phage vB_Ec_ZCEC14

The phylogenetic analysis conducted by VICTOR following phylogenomic GBDP platform has been inferred from D6 formula yielding 0% average support (Fig. 6A). OPTSIL clustering of VICTOR analysis yielded twelve species clusters, and one cluster over the generic and family levels. Phage vB_Ec_ZCEC14 clustered with closely related Escherichia phages vB_ECOM_Nami, vB_ECOM_WL-3, and EcNP1. VIRDIC calculated intergenomic similarities between vB_Ec_ZCEC14 and top BLASTn matched phages. Escherichia phages RB14 and RCML 134 were clustered in the same species and genus thresholds with vB_Ec_ZCEC14 among the shortlisted 16 phages (Fig. 6B). Additionally, the proteomic tree generated by ViPTree confirmed that vB_Ec_ZCEC14 is a member of the Straboviridae family, in the class Caudoviricetes and grouped with other Escherichia phages (Fig. 7A, B). As well, ViPTree inferred that vB_Ec_ZCEC14 is highly similar to Escherichia phages vB_ECOM_G4498 and EcNP1, Shigella phage CM8, and Yersinia phage vB_YepM_ZN18. The complete genome of these closely related phages was aligned and compared to vB_Ec_ZCEC14 highlighting the similarities and differences (Fig. 8). Coregenes analysis was performed using some selected closely related Escherichia phages (RB14, ECML-134, vB_EcoM_G4498, and vB_EcoM_SCS4). Based on pan-genome analysis, vB_Ec_ZCEC14 shared two hundred and thirty-five orthologous genes. Three signature genes (major capsid protein, large terminase subunit (Terl), and DNA polymerase) were chosen to perform sequence alignment, and further phylogenetic analysis in MEGA-11 (Fig. 9A-C). In the three trees, signature genes of phage vB_Ec_ZCEC14 were clustered with those of other Escherichia phages. Following recent updates of International Committee on Taxonomy of Viruses 2023 (ICTV), genomic characteristics and host type of phage vB_Ec_ZCEC14 fit the family Straboviridae of the class Caudoviricetes.

Fig. 6
figure 6

Phylogenetic analysis of vB_Ec_ZCEC14. (A) VICTOR phylogenetic tree of vB_Ec_ZCEC14 and top 100 BLASTn closely related phages; (B) VIRIDIC heatmap of phage vB_Ec_ZCEC14 and sixteen BLASTn closely related phages

Full size image
Fig. 7
figure 7

ViPTree proteomic tree of vB_Ec_ZCEC14 against RefSeq genomes of closely related phages. (A) Circular tree; (B) Rectangular tree illustrates a portion in the circular tree showing closely related phages

Full size image
Fig. 8
figure 8

Complete genome comparison of vB_Ec_ZCEC14 and ViPTree closely related phages

Full size image
Fig. 9
figure 9

Phylogenetic analysis of the three signature proteins of vB_Ec_ZCEC14 and top BLASTp matched of other phages using MEGA-11. (A) major capsid protein; (B) terminase large subunit (TerL); (C) DNA polymerase

Full size image

Discussion

Antibiotic resistance has become a global threat in the last years and the infections caused by antibiotic-resistant bacteria such as UTIs are becoming a great challenge to the health care sector. This raised interest in alternatives to antibiotics including bacteriophages. Our study aimed at isolating a new phage to tackle UTIs caused by E. coli. Phage vB_Ec_ZCEC14 effectively lysed twelve isolates out of 35 confirmed E. coli isolates. According to the morphological analysis and sequencing data of phage vB_Ec_ZCEC14, it belongs to Straboviridae family, with a head capsid, a contractile tail, and a 166 kbp genome size. This description is compatible with the previously reported studies about Straboviridae E. coli phage T4, that was reported to have 168 kbp approximate genome size and similar morphological features [73, 74]. Phage vB_Ec_ZCEC14 has maintained its thermal stability from the least temperature tested which is -20 ℃ to 60 ℃, and its titer decreased by two logs when incubated at 70 ℃. After incubation at 80 Â°C, phage vB_Ec_ZCEC14 titer was \( {10}^{4}\) PFU/ml. E. coli phages investigated in other studies, such as ZCEC10, ZCEC11, and ZCEC12, exhibited remarkable thermal stability from − 20 ℃ to 75 ℃, however, they were rendered completely inactive at 80 ℃ [75]. The optimum pH range for phage vB_Ec_ZCEC14 activity was between 7.0 and 11.0. Phage vB_Ec_ZCEC14 was inactive when incubated at pH 2.0 and pH 13.0. Moreover, phage vB_Ec_ZCEC14 showed high stability against UV exposure for 45 min. The replication dynamics studies of phage vB_Ec_ZCEC14 have demonstrated its ability to control the growth of EC/4 and reduce its viable bacterial count. The replication dynamics of phage vB_Ec_ZCEC14 demonstrated that its effectiveness in controlling the growth of EC/4 is concentration independent. Unlike phages ZCEC10, ZCEC11, and ZCEC12, which reduced the proliferation of E. coli O18 in a concentration-dependent manner at 0.001 to 10 MOI range, phage vB_Ec_ZCEC14 significantly reduced the bacterial population by ∼3 log10 CFU/mL at MOIs 10 and 0.1 after 60 min. A similar reduction was observed at MOI 1, but after 90 min. Phage titers increased by 4 log10 PFU/ml at MOI 0.1 and by 3 log10 PFU/ml at MOI 1, while a slight increase was observed at MOI 10, which may be due to the lysis from without (LOV). Lysis from without is identified as the early lysis of bacteria induced by phage adsorption of high multiplicity without producing new phages [76]. Consequently, the bacterial count was promptly reduced without apparent increase in the phage progeny at MOI 10.

In our study, six pathogenicity genes of E. coli (traT, fimH, blaCTX, blaSHV, blaTEM, and tetA) were tested against a selection of eight multidrug-resistant urine isolates that were sensitive to phage vB_Ec_ZCEC14 [77]. Many studies have revealed a high incidence and strong correlation between fimH and uropathogenic isolates [78, 79]. According to Abd Elbaky et al., fimH was recorded in 75% of tested E. coli isolates, with 77.7% prevalence rate [80]. The fimH gene is required in the bacterial infection process, where it is expressed as d-mannose-specific adhesion, type 1 fimbriae. Uropathogenic E. coli has more fimH, hlyA, csgA, crl, and traT genes than ExPEC and intestinal isolates because uropathogenic E. coli are more virulent than other studied isolated strains [81]. The traT virulence gene encodes the traT protein, which is a key factor in UTIs development through inducing serum resistance mechanism [82]. Serum-resistant E. coli are virulent as they may evade the immune complement system resulting in boosting of serum survival raising the prevalence of septic shock and death [83]. In this research, we reported traT gene in 77.7% of the multi-drug-resistant urine isolates. This matches the data obtained by Firozeeh et al. where traT gene was the most abundant virulence gene among all UPEC isolates collected from cystitis (67.9%) and pyelonephritis (80.6%). The traT gene is also common among urine E. coli isolates (59.1%) [84, 85]. Resistance of pathogenic E. coli to beta-lactam is often encountered by the degradative enzyme beta-lactamase, and the therapy options for extended spectrum beta-lactamase (ESBL) producing pathogens are restricted globally [86, 87]. SHV, CTX-M, and TEM are the most common ESBL genes, which mediate resistance to different classes of beta-lactam antibiotics and exist in a broad spectrum of clinically significant bacterial infections [87]. Before the 2000s, SHV and TEM were the most prevalent ESBL types; however, CTX-M enzymes have turned to be more prevalent in recent decades [88]. The elevated levels of CTX-M enzymes in the bacterial isolates are thought to be attributable to a high level of gene mobilization [89]. Barlow et al. demonstrated that there was a ten-fold increase in transfer of blaCTX-M genes encoded in a plasmid relative to other A-lactamases class [88, 90]. A genetic investigation of 115 uropathogenic E. coli isolates, which were collected from hospital-acquired infections, revealed that the most common gene was TEM (78.2%), followed by blaCTX-M (66%) and blaSHV (43.4%) [91]. This coincides with our findings, as blaCTX was the most found gene among the four tested resistance genes. The frequencies of blaCTX, blaTEM, and blaSHV in a selection of MDR E. coli isolates, which were sensitive to phage vB_Ec_ZCEC14, were 66.6%, 55.5%, and 55.5% respectively. An active efflux, mediated by an export protein is considered the cause of resistance to tetracyclines in Gram-negative bacteria [92]. Several tetracycline efflux genes have been characterized in Gram-negative bacteria, and the classification of strongly related genes was based on hybridization testing or gene sequencing [93]. In this study, tetA was screened in a selection of urine E. coli isolates, that were sensitive to phage vB_Ec_ZCEC14 and was detected at a rate of 11.11%. Our findings will provide extra benefits for competent authorities and clinicians to use phages in the fight against bacterial infections in the urinary tract. In addition, these results will boost the acknowledgement of bacteriophages in western societies and expedite the regulatory process of phage therapy.

Data availability

The dataset presented in this study can be found in online repositories. The genome sequences were deposited in GenBank under the accession numbers OP205141 and OP168898.

References

  1. Al-Anany AM, Hooey PB, Cook JD, Burrows LL, Martyniuk J, Hynes AP, et al. Phage therapy in the management of urinary tract infections: a comprehensive systematic review. PHAGE. 2023;4:112–27.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Zalewska-PiÄ…tek B, PiÄ…tek R. Phage therapy as a novel strategy in the treatment of urinary tract infections caused by E. Coli. Antibiotics. 2020;9:304.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Lin W-H, Wang M-C, Liu P-Y, Chen P-S, Wen L-L, Teng C-H, et al. Escherichia coli urinary tract infections: host age-related differences in bacterial virulence factors and antimicrobial susceptibility. J Microbiol Immunol Infect. 2022;55:249–56.

    Article  CAS  PubMed  Google Scholar 

  4. Critchley IA, Cotroneo N, Pucci MJ, Mendes R. The burden of antimicrobial resistance among urinary tract isolates of Escherichia coli in the United States in 2017. PLoS ONE. 2019;14:e0220265.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Paul R, Srivastava S, Muhammad T, Rashmi R. Determinants of acquired disability and recovery from disability in Indian older adults: longitudinal influence of socio-economic and health-related factors. BMC Geriatr. 2021;21:426.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Kalra OP, Raizada A. Approach to a patient with urosepsis. J Glob Infect Dis. 2009;1:57–63.

    Article  PubMed  PubMed Central  Google Scholar 

  7. E. coli. [cited 2024 Jan 24]. Available from: https://www.who.int/news-room/fact-sheets/detail/e-coli

  8. Pitout JDD. Extraintestinal pathogenic Escherichia coli: a combination of virulence with antibiotic resistance. Front Microbiol. 2012;3:9.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Nascimento JAS, Santos FF, Valiatti TB, Santos-Neto JF, Santos ACM, Cayô R et al. Frequency and diversity of hybrid escherichia coli strains isolated from urinary tract infections. Microorganisms. 2021;9.

  10. Kudinha T. The pathogenesis of Escherichia coli urinary tract infection. Escherichia coli - recent advances on physiology, pathogenesis and biotechnological applications. IntechOpen; 2017 [cited 2024 Jan 25]. Available from: https://www.intechopen.com/chapters/56154

  11. Katouli M. Population structure of gut Escherichia coli and its role in development of extra-intestinal infections. Iran J Microbiol. 2010;2:59.

    PubMed  PubMed Central  Google Scholar 

  12. Alanazi MQ, Alqahtani FY, Aleanizy FS. An evaluation of E. Coli in urinary tract infection in emergency department at KAMC in Riyadh, Saudi Arabia: retrospective study. Ann Clin Microbiol Antimicrob. 2018;17:3.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Amadu DO, Nwabuisi C, Yunusa T, Nasir IA, Oladejo JM, Seibu E, et al. Prevalence and associated factors associated with uropathogenic Escherichia coli isolates from catheterized persons at Ilorin Tertiary Hospital, Nigeria. Afro-Egyptian J Infect Endemic Dis. 2019;9:119–28.

    Article  Google Scholar 

  14. Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nat Reviews Microbiol 2015. 2015;13:5.

    Google Scholar 

  15. Allocati N, Masulli M, Alexeyev MF, Ilio C, Di. Escherichia coli in Europe: an overview. OPEN ACCESS Int J Environ Res Public Health. 2013;10:10.

    Google Scholar 

  16. Talebi Bezmin Abadi A, Rizvanov AA, Haertlé T, Blatt NL. World Health Organization report: current crisis of antibiotic resistance. BioNanoScience. 2019;9:778–88.

    Article  Google Scholar 

  17. Ramadan H, Soliman AM, Hiott LM, Elbediwi M, Woodley TA, Chattaway MA, et al. Emergence of multidrug-resistant Escherichia coli producing CTX-M, MCR-1, and FosA in retail food from Egypt. Front Cell Infect Microbiol. 2021;11:559.

    Article  Google Scholar 

  18. Mattila S, Ruotsalainen P, Jalasvuori M. On-demand isolation of bacteriophages against drug-resistant bacteria for personalized phage therapy. Front Microbiol. 2015;6:1271.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Oechslin F. Resistance development to bacteriophages occurring during bacteriophage therapy. Viruses. 2018;10:351.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Luong T, Salabarria AC, Roach DR. Phage therapy in the resistance era: where do we stand and where are we going? Clin Ther. 2020;42:1659–80.

    Article  CAS  PubMed  Google Scholar 

  21. Golkar Z, Bagasra O, Gene Pace D. Bacteriophage therapy: a potential solution for the antibiotic resistance crisis. J Infect Developing Ctries. 2014;8:129–36.

    Article  Google Scholar 

  22. Taha OA, Connerton PL, Connerton IF, El-Shibiny A, Bacteriophage. ZCKP1: a potential treatment for Klebsiella pneumoniae isolated from diabetic foot patients. Front Microbiol. 2018 [cited 2024 Jan 25];9. Available from: https://www.frontiersin.org/articles/https://0-doi-org.brum.beds.ac.uk/10.3389/fmicb.2018.02127

  23. Slopek S, Durlakowa I, Weber-Dabrowska B, Dabrowski M, Kucharewicz-Krukowska A. Results of bacteriophage treatment of suppurative bacterial infections. III. Detailed evaluation of the results obtained in further 150 cases. Arch Immunol Ther Exp (Warsz). 1984;32:317–35.

    CAS  PubMed  Google Scholar 

  24. Slopek S, Kucharewicz-Krukowska A, Weber-Dabrowska B, Dabrowski M. Results of bacteriophage treatment of suppurative bacterial infections. V. evaluation of the results obtained in children. Arch Immunol Ther Exp (Warsz). 1985;33:241–59.

    CAS  PubMed  Google Scholar 

  25. Silva C, Sá S, Guedes C, Oliveira C, Lima C, Oliveira M, et al. The history and applications of phage therapy in pseudomonas aeruginosa. Microbiol Res. 2022;13:14–37.

    Article  CAS  Google Scholar 

  26. Neamati F, Firoozeh F, Saffari M, Zibaei M. Virulence genes and antimicrobial resistance pattern in uropathogenic Escherichia coli isolated from hospitalized patients in Kashan, Iran. Jundishapur J Microbiol. 2015;8:e17514.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Takahashi A, Kanamaru S, Kurazono H, Kunishima Y, Tsukamoto T, Ogawa O, et al. Escherichia coli isolates associated with uncomplicated and complicated cystitis and asymptomatic bacteriuria possess similar phylogenies, virulence genes, and O-serogroup profiles. J Clin Microbiol. 2006;44:4589–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Mendonça N, Leitão J, Manageiro V, Ferreira E, Caniça M. Spread of extended-spectrum β-lactamase CTX-M-producing Escherichia coli clinical isolates in community and nosocomial environments in Portugal. Antimicrob Agents Chemother. 2007;51:1946–55.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Adesiji YO, Shivakumaraswamy SK, Kumar Deekshit V, Kallappa GS, Karunasagar I, Adesiji Y. Molecular characterization of antimicrobial multi-drug resistance in non-typhoidal salmonellae from chicken and clam in Mangalore, India. J Biomedical Res. 2018;32:237–44.

    Article  CAS  Google Scholar 

  30. Kpoda DS, Ajayi A, Somda M, Traore O, Guessennd N, Ouattara AS, et al. Distribution of resistance genes encoding ESBLs in enterobacteriaceae isolated from biological samples in health centers in Ouagadougou, Burkina Faso. BMC Res Notes. 2018;11:471.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Sid Ahmed MA, Bansal D, Acharya A, Elmi AA, Hamid JM, Sid Ahmed AM, et al. Antimicrobial susceptibility and molecular epidemiology of extended-spectrum beta-lactamase-producing enterobacteriaceae from intensive care units at Hamad medical corporation, Qatar. Antimicrob Resist Infect Control. 2016;5:1–6.

    Article  Google Scholar 

  32. KIRBY WM, YOSHIHARA GM, WARREN SUNDSTEDKS. JH. Clinical usefulness of a single disc method for antibiotic sensitivity testing. Antibiot Annual. 1956;892–7.

  33. Daoud N, Hamdoun M, Hannachi H, Gharsallah C, Mallekh W, Bahri O. Antimicrobial susceptibility patterns of Escherichia coli among Tunisian outpatients with community-acquired urinary tract infection (2012–2018). Curr Urol. 2020;14:200–5.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Kidsley AK, Abraham S, Bell JM, O’Dea M, Laird TJ, Jordan D, et al. Antimicrobial susceptibility of Escherichia coli and Salmonella Spp. Isolates from healthy pigs in Australia: results of a Pilot National Survey. Front Microbiol. 2018;9:1207.

    Article  PubMed  PubMed Central  Google Scholar 

  35. M100Ed33| Performance Standards for Antimicrobial Susceptibility Testing., 33rd Edition. Clinical & Laboratory Standards Institute. [cited 2024 Jan 25]. Available from: https://clsi.org/standards/products/microbiology/documents/m100/

  36. Makky S, Abdelsattar AS, Habashy M, Dawoud A, Nofal R, Hassan A, et al. Phage ZCSS1 from isolation to application against Staphylococcus sciuri and biofilm: a prospect of utilizing temperate phage and its products. Gene Rep. 2023;32:101792.

    Article  CAS  Google Scholar 

  37. Bourdin G, Schmitt B, Guy LM, Germond JE, Zuber S, Michot L, et al. Amplification and purification of T4-like Escherichia coli phages for phage therapy: from laboratory to pilot scale. Appl Environ Microbiol. 2014;80:1469–76.

    Article  PubMed  PubMed Central  ADS  Google Scholar 

  38. Maaløe O, Watson JD. The transfer of radioactive phosphorus from parental to progeny phage. P Natl A Sci. 1951;37:507–13.

  39. Echeverría-Vega A, Morales-Vicencio P, Saez-Saavedra C, Gordillo-Fuenzalida F, Araya R. A rapid and simple protocol for the isolation of bacteriophages from coastal organisms. MethodsX. 2019;6:2614–9.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Schiettekatte O, Bourhy P. Isolation, purification, and characterization of leptophages. Methods Mol Biol. 2020;2134:67–75.

    Article  CAS  PubMed  Google Scholar 

  41. Makky S, Rezk N, Abdelsattar AS, Hussein AH, Eid A, Essam K, et al. Characterization of the biosynthesized syzygium aromaticum-mediated silver nanoparticles and its antibacterial and antibiofilm activity in combination with bacteriophage. Results in Chemistry. 2023;5:100686.

    Article  CAS  Google Scholar 

  42. Fayez MS, Hakim TA, Zaki BM, Makky S, Abdelmoteleb M, Essam K, et al. Morphological, biological, and genomic characterization of Klebsiella pneumoniae phage vB_Kpn_ZC2. Virol J. 2023;20:86.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Islam MS, Zhou Y, Liang L, Nime I, Liu K, Yan T, et al. Application of a phage cocktail for control of salmonella in foods and reducing biofilms. Viruses. 2019;11:841.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Mazzocco A, Waddell TE, Lingohr E, Johnson RP. Enumeration of bacteriophages using the small drop plaque assay system. Methods in molecular biology (Clifton NJ). 2009;501:81–5.

    CAS  Google Scholar 

  45. Anand T, Virmani N, Kumar S, Mohanty AK, Pavulraj S, Bera BC, et al. Phage therapy for treatment of virulent Klebsiella pneumoniae infection in a mouse model. J Global Antimicrob Resist. 2020;21:34–41.

    Article  Google Scholar 

  46. El-Tawab A, Isolation. Characterization, and efficacy of three lytic phages infecting multidrug-resistant salmonella serovars from poultry farms in Egypt. Arch Razi Inst. 2021;76:507–19.

    Google Scholar 

  47. O’Flynn G, Ross RP, Fitzgerald GF, Coffey A. Evaluation of a cocktail of three bacteriophages for biocontrol of Escherichia coli O157:H7. Appl Environ Microbiol. 2004;70:3417–24.

    Article  PubMed  PubMed Central  ADS  Google Scholar 

  48. Kutter E. Phage host range and efficiency of plating. Methods in molecular biology. (Clifton NJ). 2009;501:141–9.

    CAS  Google Scholar 

  49. Cerveny KE, DePaola A, Duckworth DH, Gulig PA. Phage therapy of local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated mice. Infect Immun. 2002;70:6251–62.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Fayez MS, Hakim TA, Agwa MM, Abdelmoteleb M, Aly RG, Montaser NN et al. Topically applied bacteriophage to control multi-drug resistant klebsiella pneumoniae infected wound in a rat model. Antibiotics. 2021;10.

  51. Louie M, Jayaratne P, Luchsinger I, Devenish J, Yao J, Schlech W, et al. Comparison of ribotyping, arbitrarily primed PCR, and pulsed-field gel electrophoresis for molecular typing of Listeria monocytogenes. J Clin Microbiol. 1996;34:15–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Esmael A, Azab E, Gobouri AA, Nasr-Eldin MA, Moustafa MMA, Mohamed SA, et al. Isolation and characterization of two lytic bacteriophages infecting a multi-drug resistant salmonella typhimurium and their efficacy to combat salmonellosis in ready-to-use foods. Microorganisms. 2021;9:423.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Armon R, Kott Y. A simple, rapid and sensitive presence/absence detection test for bacteriophage in drinking water. J Appl Bacteriol. 1993;74:490–6.

    Article  CAS  PubMed  Google Scholar 

  54. Miles AA, Misra SS, Irwin JO. The estimation of the bactericidal power of the blood. J Hygiene. 1938;38:732–49.

    CAS  Google Scholar 

  55. Zaki BM, Fahmy NA, Aziz RK, Samir R, El-Shibiny A. Characterization and comprehensive genome analysis of novel bacteriophage, vB_Kpn_ZCKp20p, with lytic and anti-biofilm potential against clinical multidrug-resistant Klebsiella pneumoniae. Front Cell Infect Microbiol. 2023;13:3.

    Article  Google Scholar 

  56. Valério N, Oliveira C, Jesus V, Branco T, Pereira C, Moreirinha C, et al. Effects of single and combined use of bacteriophages and antibiotics to inactivate Escherichia coli. Virus Res. 2017;240:8–17.

    Article  PubMed  Google Scholar 

  57. Clarke AL, De Soir S, Jones JD. The safety and efficacy of phage therapy for bone and joint infections: a systematic review. Antibiot (Basel Switzerland). 2020;9:1–11.

    Google Scholar 

  58. Andrews S. FastQC: a quality control tool for high throughput sequence data. 2010. Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

  59. Schmieder R, Edwards R. Quality control and preprocessing of metagenomic datasets. Bioinformatics. 2011;27:863–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biology: J Comput Mol cell Biology. 2012;19:455–77.

    Article  MathSciNet  CAS  Google Scholar 

  61. Gurevich A, Saveliev V, Vyahhi N, Tesler G. QUAST: quality assessment tool for genome assemblies. Bioinf (Oxford England). 2013;29:1072–5.

    CAS  Google Scholar 

  62. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.

    Article  CAS  PubMed  Google Scholar 

  63. Davis JJ, Wattam AR, Aziz RK, Brettin T, Butler R, Butler RM, et al. The PATRIC bioinformatics resource center: expanding data and analysis capabilities. Nucleic Acids Res. 2020;48:D606–12.

    CAS  PubMed  Google Scholar 

  64. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. The RAST server: rapid annotations using subsystems technology. BMC Genomics. 2008;9:75.

    Article  PubMed  PubMed Central  Google Scholar 

  65. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  66. Hallgren J, Tsirigos KD, Pedersen MD, Armenteros JJA, Marcatili P, Nielsen H et al. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. bioRxiv; 2022 [cited 2024 Jan 25]. p. 2022.04.08.487609. Available from: https://www.biorxiv.org/content/10.1101/2022.04.08.487609v1

  67. Meier-Kolthoff JP, Göker M. VICTOR: genome-based phylogeny and classification of prokaryotic viruses. Bioinformatics. 2017;33:3396–404.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  68. Meier-Kolthoff JP, Auch AF, Klenk H-P, Göker M. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinformatics. 2013;14:60.

    Article  PubMed  PubMed Central  Google Scholar 

  69. Moraru C, Varsani A, Kropinski AM. VIRIDIC-A novel tool to calculate the intergenomic similarities of prokaryote-infecting viruses. Viruses. 2020;12:1268.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. Nishimura Y, Yoshida T, Kuronishi M, Uehara H, Ogata H, Goto S. ViPTree: the viral proteomic tree server. Bioinf (Oxford England). 2017;33:2379–80.

    CAS  Google Scholar 

  71. Turner D, Reynolds D, Seto D, Mahadevan P. CoreGenes3.5: a webserver for the determination of core genes from sets of viral and small bacterial genomes. BMC Res Notes. 2013;6:140.

    Article  PubMed  PubMed Central  Google Scholar 

  72. Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38:3022–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  73. Miller ES, Kutter E, Mosig G, Arisaka F, Kunisawa T, Rüger W. Bacteriophage T4 genome. Microbiol Mol Biol Rev. 2003;67:86.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  74. Yap ML, Rossmann MG. Structure and function of bacteriophage T4. Future Microbiol. 2014;9:1319.

    Article  CAS  PubMed  Google Scholar 

  75. Abdelrahman F, Rezk N, Fayez MS, Abdelmoteleb M, Atteya R, Elhadidy M, et al. Isolation, characterization, and genomic analysis of three novel E. Coli bacteriophages that effectively infect E. Coli O18. Microorganisms. 2022;10:589.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  76. Abedon ST. Lysis from without. Bacteriophage. 2011;1:46–9.

    Article  PubMed  PubMed Central  Google Scholar 

  77. Chapman TA, Wu XY, Barchia I, Bettelheim KA, Driesen S, Trott D, et al. Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine. Appl Environ Microbiol. 2006;72:4782.

    Article  CAS  PubMed  PubMed Central  ADS  Google Scholar 

  78. Malekzadegan Y, Khashei R, Sedigh Ebrahim-Saraie H, Jahanabadi Z. Distribution of virulence genes and their association with antimicrobial resistance among uropathogenic Escherichia coli isolates from Iranian patients 11 medical and health sciences 1108 medical microbiology. BMC Infect Dis. 2018;18.

  79. Rezatofighi SE, Mirzarazi M, Salehi M. Virulence genes and phylogenetic groups of uropathogenic Escherichia coli isolates from patients with urinary tract infection and uninfected control subjects: a case-control study. BMC Infect Dis. 2021;21:1–11.

    Article  Google Scholar 

  80. Abd El-Baky RM, Ibrahim RA, Mohamed DS, Ahmed EF, Hashem ZS. Prevalence of virulence genes and their association with antimicrobial resistance among pathogenic E. Coli isolated from Egyptian patients with different clinical infections. Infect Drug Resist. 2020;13:1221–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  81. Firoozeh F, Saffari M, Neamati F, Zibaei M. Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelonephritis. Int J Infect Dis. 2014;29:219–22.

    Article  CAS  PubMed  Google Scholar 

  82. El-baz R, Said HS, Abdelmegeed ES, Barwa R. Characterization of virulence determinants and phylogenetic background of multiple and extensively drug resistant Escherichia coli isolated from different clinical sources in Egypt. Appl Microbiol Biotechnol. 2022;106:1279–98.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  83. Bryskier A. Penicillins Antimicrob Agents. 2014;113–62.

  84. Islam MS, Sobur MA, Rahman S, Ballah FM, Ievy S, Siddique MP, et al. Detection of blaTEM, blaCTX-M, blaCMY, and blaSHV genes among extended-spectrum beta-lactamase-producing Escherichia coli isolated from migratory birds travelling to Bangladesh. Microb Ecol. 2021;83:942–50.

    Article  PubMed  PubMed Central  ADS  Google Scholar 

  85. Ngaiganam EP, Pagnier I, Chaalal W, Leangapichart T, Chabou S, Rolain JM, et al. Investigation of urban birds as source of β-lactamase-producing Gram-negative bacteria in Marseille city, France. Acta Vet Scand. 2019;61:1–7.

    Article  CAS  Google Scholar 

  86. D’Andrea MM, Arena F, Pallecchi L, Rossolini GM. CTX-M-type β-lactamases: a successful story of antibiotic resistance. Int J Med Microbiol. 2013;303:305–17.

    Article  PubMed  Google Scholar 

  87. Seyedjavadi SS, Goudarzi M, Sabzehali F. Relation between blaTEM, blaSHV and blaCTX-M genes and acute urinary tract infections. J Acute Disease. 2016;5:71–6.

    Article  Google Scholar 

  88. Barlow M, Reik RA, Jacobs SD, Medina M, Meyer MP, McGowan JE, et al. High rate of mobilization for blaCTX-Ms - volume 14, number 3—March 2008 - emerging infectious diseases journal - CDC. Emerg Infect Dis. 2008;14:423–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  89. Hamed H, Gaber A, EL Sehsah EM, Author C, Hamed Saleh H. Detection of β-lactamase genes (blaTEM, Bla CTX-M and bla SHV) in uropathogens isolated from patients with UTI Key words: Beta-lactamase genes{bla(TEM), bla(CTX-M), and Bla(SHV)}, uropathogens, and UTI. Egypt J Med Microbiol. 2021;30:97–103.

    Article  Google Scholar 

  90. Paulsen IT, Brown MH, Skurray RA. Proton-dependent multidrug efflux systems. Microbiol Rev. 1996;60:575–608.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  91. Levy SB, McMurry LM, Burdett V, Courvalin P, Hillen W, Roberts MC, et al. Nomenclature for tetracycline resistance determinants. Antimicrob Agents Chemother. 1989;33:1373–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  92. Levy SB, McMurry LM, Barbosa TM, Burdett V, Courvalin P, Hillen W, et al. Nomenclature for new tetracycline resistance determinants. Antimicrob Agents Chemother. 1999;43:1523–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  93. Guillaume G, Verbrugge D, Chasseur-Libotte ML, Moens W, Collard JM. PCR typing of tetracycline resistance determinants (Tet A–E) in Salmonella enterica serotype Hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol Ecol. 2000;32:77–85.

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

The authors would like to thank Dr. Rania M. Kishk; Professor of Microbiology and Immunology at the Faculty of Medicine of the Suez Canal university, and Consultant of infection prevention and control at the Suez Canal university hospital for providing the E. coli isolates used in this study and thanks to Mohamed S. Fayez for finalizing the manuscript.

Funding

This research was funded by the Egyptian Sciences and Technology Development Fund (STDF), grant #41909.

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Author information

Authors and Affiliations

  1. Center for Microbiology and Phage Therapy, Zewail City of Science and Technology, 12578, Giza, Egypt

    Nedaa M. Ismael, Mohamed Azzam & Ayman El-Shibiny

  2. Department of Botany, Faculty of Science, Mansoura University, 35516, Mansoura, Egypt

    Mohamed Abdelmoteleb

  3. Faculty of Environmental Agricultural Sciences, Arish University, 45511, Arish, Egypt

    Ayman El-Shibiny

Authors
  1. Nedaa M. Ismael
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mohamed Azzam
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mohamed Abdelmoteleb
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Ayman El-Shibiny
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization, N.M.I. and A.E.-S.; methodology, N.M.I., M.A (Mohamed Azzam)., A.E.-S.; software, M.A. (Mohamed Abdelmoteleb), and M.A. (Mohamed Azzam); validation, N.M.I., M.A. (Mohamed Abdelmoteleb), M.A. (Mohamed Azzam)and A.E.-S.; writing—original draft preparation, N.M.I., M.A. (Mohamed Azzam), M.A. (Mohamed Abdelmoteleb), and A.E.-S.; writing—review and editing, N.M.I. and A.E.-S.; visualization, N.M.I., M.A. (Mohamed Abdelmoteleb), M.A (Mohamed Azzam), and A.E.-S.; supervision, A.E.-S.; project administration, A.E.-S.; funding acquisition, A.E.-S. All authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Ayman El-Shibiny.

Ethics declarations

Institutional review board statement

Not applicable.

Informed consent

Not Applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1: Table S1.

Phage vB_Ec_ZCEC14 genome annotation

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ismael, N.M., Azzam, M., Abdelmoteleb, M. et al. Phage vB_Ec_ZCEC14 to treat antibiotic-resistant Escherichia coli isolated from urinary tract infections. Virol J 21, 44 (2024). https://0-doi-org.brum.beds.ac.uk/10.1186/s12985-024-02306-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12985-024-02306-0

Keywords

Virology Journal

ISSN: 1743-422X