Skip to main content
Download PDF

HPyV6 and HPyV7 in urine from immunocompromised patients

Virology Journal volume 18, Article number: 24 (2021) Cite this article

Abstract

Background

Human polyomavirus 6 (HPyV6) and HPyV7 are two of the novel polyomaviruses that were originally detected in non-diseased skin. Serological studies have shown that these viruses are ubiquitous in the healthy adult population with seroprevalence up to 88% for HPyV6 and 72% for HPyV7. Both viruses are associated with pruritic skin eruption in immunocompromised patients, but a role with other diseases in immunoincompetent patients or malignancies has not been established.

Methods

PCR was used to determine the presence of HPyV6 and HPyV7 DNA in urine samples from systemic lupus erythematosus (n = 73), multiple sclerosis (n = 50), psoriasis vulgaris (n = 15), arthritic psoriasis (n = 15) and HIV-positive patients (n = 66). In addition, urine from pregnant women (n = 47) and healthy blood donors (n = 20) was investigated.

Results

HPyV6 DNA was detected in 21 (28.8%) of the urine specimens from SLE patients, in 6 (9.1%) of the urine samples from the HIV-positive cohort, and in 19 (40.4%) samples from pregnant women. HPyV7 DNA was only found in 6 (8.2%) of the urine specimens from SLE patients and in 4 (8.5%) samples from pregnant women. No HPyV6 and HPyV7 viruria was detected in the urine samples from the other patients.

Conclusions

HPyV6, and to a lesser extend HPyV7, viruria seems to be common in SLE and HIV-positive patients, and pregnant women. Whether these viruses are of clinical relevance in these patients is not known.

Background

A virus was isolated in the 1950ies from mouse and because of its ability to induce multiple tumors in animal models named polyomavirus (PyV) [1]. Since then, PyVs have been described in other mammals, including humans, birds, and fish [2, 3]. Members of the Polyomaviridae family are characterized by non-enveloped virus particles containing a circular double-stranded DNA genome of approximately 5000 base-pairs (bp). A typical PyV genome codes for the regulatory proteins large T-antigen (LT) and small T-antigen (sT) and at least two capsid proteins, VP1 and VP2. The T-antigens are expressed early during the infection cycle, and are required for viral transcription and replication [4]. These proteins possess oncogenic properties [5,6,7]. The capsid proteins are expressed after viral replication has initiated and therefore later during infection of the host cell. A non-coding region (NCCR), which encompasses the origin of replication and the transcription regulatory sequences for both the T-antigens and the VPs, separates the coding regions for the T-antigens and capsid proteins [4].

So far, 15 polyomavirus genomes have been isolated from humans. In 1971, BKPyV and JCPyV were the first human PyVs to be described in literature. They were isolated from urine of a renal transplant patient and the brain from a patient with progressive multifocal encephalopathy (PML), respectively [8, 9]. Since then, novel PyVs were originally described in nasopharyngeal aspirates (KIPyV; [10]), bronchoalveolar lavage (WUPyV; [11]), Merkel cell carcinoma (MCPyV; [12]), skin (HPyV6, HPyV7, TSPyV, LIPyV; [13,14,15]), serum (HPyV9; [16]), genital warts (HPyV10; [17]), feces (STLPyV, QPyV; [18, 19]), liver (HPyV12; [20]), and muscle (NJPyV; [21]). Although HPyVs seem to establish a harmless persistent infection in healthy individuals [22, 23], they may cause diseases in immunocompromised patients. BKPyV is associated with nephropathy in renal transplant recipients and hemorrhagic cystitis in hematopoietic stem cell transplantation [24, 25]. JCPyV causes PML and few cases of JCPyV-associated nephropathy in renal transplant patients have been observed [26,27,28]. MCPyV is the cause of Merkel cell carcinoma, a neuroendocrine skin cancer [12], and TSPyV is the etiological factor of trichodysplasia spinulosa in immunodeficient patients [29].

Serological studies have demonstrated that HPyV6 and HPyV7 infections are ubiquitous in the healthy adult human population, with a seroprevalence ranging between 74 and 93% for HPyV6 and between 56 and 80% for HPyV7 [30,31,32,33,34]. The presence of HPyV6 and HPyV7 DNA has been examined in different biological samples of healthy controls and different patient groups in a quest to determine the cell tropism and the possible association of these viruses with diseases. HPyV6 and HPyV7 are natural inhabitants of the healthy skin virome [13, 35,36,37,38,39]. These viruses have been detected in other specimens. HPyV6 was present in the urine from one out of 70 patients with hemorrhagic cystitis [40], and HPyV7 was found in urine from one out of 100 liver transplant patients [41] and from five out of 43 hematopoietic stem cell transplant patients [40]. HPyV6, but not HPyV7, was detected in cerebrospinal fluid (CSF) from one out of 243 neurological patients [42] and from one HIV-positive patient with JCPyV-negative progressive multifocal leukoencephalopathy [43]. HPyV6 DNA could be amplified from two out 110 serum samples from HIV-negative patients [44], and from nasopharyngeal aspirates [45] and lymph nodes [46]. HPyV7 DNA was present in the blood from a patient with dyskeratotic dermatosis [47]. Both viruses are also present in eyebrow hair from healthy men [38], and in cervical specimens of women [48].

Clear associations with diseases have not been established, except in severely immunocompromised patients, where HPyV6 and HPyV7 can cause pruritic dermatoses characterized by hyperproliferation of dyskeratotic (with premature or altered differentiation) keratinocytes that result in brownish skin plaques [49,50,51,52,53]. The presence of HPyV6 has sporadically been detected in the skin from lichen simplex chronicus, eosinophilic pustular folliculitis and suppurative foliculitis patients [39, 54]. HPyV6 has also been associated with Kimura disease and patients with dermatopathic lymphadenitis [46, 55]. HPyV6, but not HPyV7 DNA was present in anal/rectal swabs of some men who had sex with men that were HIV-negative, but neither HPyV6 nor HPyV7 were detected in throat/oral swabs and in urethral specimens from these subjects [56].

A role for HPyV6 and HPyV7 in human cancers is lacking although low viral genome copy numbers have been found in few samples of different tumor tissue types [39, 44, 57,58,59,60,61,62,63,64,65,66,67,68,69].

To further exploit a possible causative role of HPyV6 and HPyV7 in immunocompromised patients, we examined the presence of DNA from these viruses in urine from systemic lupus erythematosus (SLE), HIV positive, psoriasis, and multiple sclerosis patients, as well as in urine from pregnant women and healthy blood donors. HPyV6 viruria was found in SLE patients, HIV-positive patients and pregnant women, whereas HPyV7 DNA was only detected in SLE and HIV-positive patients. The prevalence of HPyV6 was higher than HPyV7 in these two patient groups. Longitudinal study of the SLE patients showed intermittent viruria.

Methods

Patients’ samples

Archival urine samples from five anonymous SLE patients (four women and one man) from Stavanger (Norway) were used. These samples were acquired over a 1-year period. In total, 73 samples were collected [70]. Forty-seven single archival urine specimens from healthy women who were 18–39 weeks pregnant, collected at the university hospital of Northern Norway, have been previously described [70]. The urine samples were stored as 1 ml aliquots in a − 20 °C freezer that was only used for storage of samples. The freezer stands in a different room separated from the lab, PCR room and post PCR room. The urine samples from SLE patients and from pregnant women were kept in separate drawers in the − 20 °C freezer. The study was approved by the Regional Committees for Medical and Health Research Ethics (REK; reference number 2012/420). Fifty urine samples were obtained from a cohort of 30 relapsing remitting multiple sclerosis (RRMS) subjects, followed up at the Department of Human Neurosciences of Sapienza University of Rome and recruited between March 2016 and March 2018. All participants fulfilled the Italian Agency of Drug (AIFA) criteria for natalizumab treatment and the therapeutic protocol consisted of administration of 300 mg intravenous natalizumab every 4 weeks. The enrolled patients (12 males/18 females, mean age ± stand. dev: 30.2 ± 6.6; mean months of illness ± stand. dev. 85 ± 85.5; mean Expanded Disability Status Scale (EDSS) ± stand. dev. 1.9 ± 1.3) were visited before natalizumab treatment (baseline: 0 infusions) and after infusions at weeks 4, 8, 12, 16 and 20. Patients signed informed consent based on the approved Ethic Committee of Policlinico Umberto I of Rome (protocol number 130/13). Sixty-six urine specimens were collected from a cohort of 66 HIV-1-positive patients, admitted to the Infectious Diseases Clinic of the Polyclinic Tor Vergata Foundation from January 2019 to December 2019. Among the enrolled patients (55 males/11 females, age ranged from 21 to 76 years old: mean age ± stand. dev: 40.5 years old; median: 39.9 years old) 22 were new diagnoses naive to treatment and 44 were experienced patients on treatment with a triple-based antiretroviral regimen including protease/reverse transcriptase/integrase inhibitors. The study was approved by the local Ethic Committee of the University Hospital Tor Vergata (Rome, Italy) (protocol number 0027234/2018, 19 December 2018), and patients informed consent was ascertained. Healthy donors (n = 20), aged 18 ± 63 years, were recruited from blood donors attending the Italian Red Cross Blood Transfusion Centre in Rome (RMTC) and a sample of urine was obtained. Thirty urine specimens were collected from a cohort of 30 psoriasis patients, of both genders with a mean age of 33 ± 4 years, referred to the Dermatology Institute IDI IRCSS of Rome. One group of subjects, consisting of 15 patients, diagnosed with psoriasis vulgaris and the another 15 patients were diagnosed with psoriatic arthritis. These subjects did not show other autoimmune and chronic diseases. Informed consent was obtained from all patients.

DNA purification and PCR

DNA was purified from 200 µl urine samples. The samples were centrifuged for 1 min at 12,000 g to remove cell debris. DNA purification was performed on cell-cleared urine using the QIAamp MinElute Virus Spin Kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany; cat. No. 57704). DNA was eluted in 50 µl and 5 µl was used in PCR. The following primers were used to amplify a 299 bp fragment of LT: HPyV6LT.F: CAATGCATCACTACCTGGAC (nucleotides 4316-4335 in isolate 601a; HM011558) and HPyV6LT.R: GTTTGGGATTTCCGTTTGTG (nucleotides 4595-4614 in isolate 601a; HM011558). For HPyV7, a 344 bp fragment of LT was amplified using the primers HPyV7LT.F: CACGCAGGGCTTCCATATGG (nucleotides 4267-4282 in isolate 713a; HM011586) and HPyV7LT.R: GGTTTAAGAGCCTGCTGTTG-3′ (nucleotides 4591-4610 in isolate 713a; HM011586). The PCR conditions were 40 cycles of 30 s at 90 °C, 30 s at 55 °C, and 1 min at 72 °C. PCR was performed with Accustart II PCR SuperMix (Qunatabio, Beverly, MA, USA; cat. no. 95137-500). The plasmids pHPyV6-607a (Addgene, Watertown, MA, USA; cat. no. 24727) and pHPyV7-713a (Addgene; cat. no. 24728) were used as positive controls and to test the sensitivity of our PCR.

Statistical analysis

HPyV6 and HPyV7 detection were summarized by counts and proportions. If continuous variables were normally distributed, they were expressed as mean ± SD; if not, they were expressed by median and range. The χ2 test was performed to evaluate differences in the viral detection and the Mann–Whitney U-test for non-normally distributed continuous variables was applied to analyse differences between patients. A p value < 0.05 was considered statistically significant.

Results

To investigate whether other immunocompromised conditions may lead to viruria of HPyV6 and HPyV7, urine specimens of five cohorts were examined for the presence of DNA of these viruses. The cohorts included: systemic lupus erythematosus (SLE) patients, multiple sclerosis patients, HIV-positive patients, psoriasis patients and pregnant women. HPyV6 DNA was detected in 28.8% of the urine specimens from SLE patients and in 40.4% of the samples from pregnant women (Table 1). No HPyV6 could be amplified in urine from multiple sclerosis and psoriasis patients and from healthy blood donors. HPyV7 DNA was only detected in urine from SLE and pregnant women, although with a lower prevalence than HPyV6 (8.2% and 8.5%, respectively). The HPyV7-positive urine samples from SLE patient 3 were also HPyV6 positive. Two unique urine samples from SLE patient 4 and patient 5 contained both HPyV6 and HPyV7. Of the four HPyV7 positive urine samples from pregnant women, two were also positive for HPyV6. Six of the HIV-positive patients had HPyV6 viruria, but none had HPyV7 viruria. Interestingly, the six HIV patients with a HPyV6 positive urine sample were naïve, i.e., they had just started HAART treatment. HPyV6 and HPyV7 was not detected in any of the urine specimens from healthy blood donors, multiple sclerosis patients and psoriasis patients. No significant association was found between the presence of HPyV6 and HPyV 7 DNA versus age and gender when applicable, and HPyV6 and HPyV7 DNA versus disease (p < 0.05).

Table 1 DNA prevalence of HPyV6 and HPyV7 in different patient groups
Full size table

Discussion

HPyV6 and HPyV7 DNA has been detected in different body samples of immunocompromised patients [39, 43, 49,50,51,52,53], but viruria of these viruses has not been examined in SLE and MS patients and in pregnant women. We found that DNA of both viruses was detected in the urine from some SLE patient and pregnant women, with a higher prevalence of HPyV6 compared to HPyV7. A previous study failed to detect HPyV6 and HPyV7 DNA in skin from two SLE patients [39]. Similar to HPyV6 and HPyV7, intermittent episodes of urine shedding of BKPyV and JCPyV and simultaneous viruria of BKPyV and JCPyV was observed in SLE patients [70,71,72,73,74,75].

We could not detect HPyV6 or HPyV7 urine shedding in MS patients treated with natalizumab. CSF from 10 MS patients were negative for HPyV6 and HPyV7 DNA [42], suggesting that reactivation of these two HPyVs may be a rare event in MS patients. Studies by several groups have shown that BKPyV, JCPyV or both can be detected in urine from MS patients receiving natalizumab or β-interferon [76,77,78,79,80,81], indicating that HPyV viruria is not uncommon in these patients.

We did not discover HPyV6 and HPyV7 DNA in the urine samples of healthy blood donors. This is in agreement with a previous study that also failed to detect HPyV6 in the urine from 50 healthy volunteers [82] or in 189 urine specimens from symptomatic children and adults undergoing routine diagnostic testing [83]. A longitudinal study on 169 urine samples obtained from 32 organ transplant patients showed only one urine sample positive for HPyV7 DNA. This sample was obtained from a liver transplant child 8 months after transplantation [41].

The presence of HPyV6, but not HPyV7 DNA has been described in CSF, serum, and anal/rectal swabs from HIV-positive individuals [42, 43, 56], but neither HPyV6 nor HPyV7 were found in urethral samples or urine [56, 84]. We found that 6 of our 66 HIV-positive subjects displayed HPyV6 viruria, whereas Torres et al., examined only 19 urine samples [84]. The relative small number of subjects in the latter study may explain the different findings with our results.

Hashida and colleagues examined nonlesional and lesional skin swabs from 30 psoriasis patients and reported that 58% (nonlesional) and 54% (lesional) samples were HPyV6 positive, while the HPyV7 prevalence was 42% and 25%. Of the skin swabs from healthy individuals, 14% were positive for HPyV6 and 6% were positive for HPyV7. The viral loads were also higher in both nonlesional and lesional samples of the psoriasis patients compared to the healthy individuals, indicating that HPyV6 and HPyV7 infection is higher in this inflammatory skin condition [85].

While PCR-based studies have shown that BKPyV and JCPyV viruria is common in pregnant women [86,87,88,89], less is known about urinal excretion of the novel HPyV. Cosma et al. [90] examine KIPyV, WUPyV and HPyV9 viruria in 100 non-pregnant and 100 pregnant women and found HPyV9 viruria in 2 non-pregnant and 3 pregnant women, whereas no KIPyV and WUPyV was detected in either cohorts. To the best of our knowledge, HPyV6 and HPyV7 viruria has not been investigated in pregnant women. We found that 40.4% of the women were positive for HPyV6 and 8.5% were positive for HPyV7. Two of the women (4.3%) had a urine sample that contained DNA of both viruses.

Conclusions

In conclusion, immunodeficient conditions in SLE and HIV-positive patients may lead to viruria of HPyV6 and HPyV7, but whether these observations are linked to clinical conditions remain to be further explored. Our longitudinal study on SLE patients show that some of these patients may have intermitted episodes of HPyV6/7 reactivation.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Abbreviations

CSF:

Cerebrospinal fluid

HPyV:

Human polyomavirus

MS:

Multiple sclerosis

VP:

Viral protein

SLE:

Systemic lupus erythematosus

References

  1. Gross L. A filterable agent, recovered from Ak leukemic extracts, causing salivary gland carcinomas in C3H mice. Proc Soc Exp Biol Med. 1953;83:414–21.

    Article  CAS  PubMed  Google Scholar 

  2. Buck CB, Van Doorslaer K, Peretti A, Geoghegan EM, Tisza MJ, An P, Katz JP, Pipas JM, McBride AA, Camus AC, et al. The ancient evolutionary history of polyomaviruses. PLoS Pathog. 2016;12:e1005574.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  3. Calvignac-Spencer S, Feltkamp MC, Daugherty MD, Moens U, Ramqvist T, Johne R, Ehlers B. A taxonomy update for the family Polyomaviridae. Arch Virol. 2016;161:1739–50.

    Article  CAS  PubMed  Google Scholar 

  4. Moens U, Krumbholz A, Ehlers B, Zell R, Johne R, Calvignac-Spencer S, Lauber C. Biology, evolution, and medical importance of polyomaviruses: an update. Infect Genet Evol. 2017;54:18–38.

    Article  CAS  PubMed  Google Scholar 

  5. Moens U, Van Ghelue M, Johannessen M. Oncogenic potentials of the human polyomavirus regulatory proteins. Cell Mol Life Sci. 2007;64:1656–78.

    Article  CAS  PubMed  Google Scholar 

  6. Topalis D, Andrei G, Snoeck R. The large tumor antigen: a “Swiss Army knife” protein possessing the functions required for the polyomavirus life cycle. Antivir Res. 2013;97:122–36.

    Article  CAS  PubMed  Google Scholar 

  7. Baez CF, Brandão Varella R, Villani S, Delbue S. Human polyomaviruses: the battle of large and small tumor antigens. Virology (Auckl). 2017;8:1178122–17744785.

    Google Scholar 

  8. Padgett BL, Walker DL, ZuRhein GM, Eckroade RJ, Dessel BH. Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet. 1971;1:1257–60.

    Article  CAS  PubMed  Google Scholar 

  9. Gardner SD, Field AM, Coleman DV, Hulme B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet. 1971;1:1253–7.

    Article  CAS  PubMed  Google Scholar 

  10. Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, Dalianis T, Ramqvist T, Andersson B. Identification of a third human polyomavirus. J Virol. 2007;81:4130–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Gaynor AM, Nissen MD, Whiley DM, Mackay IM, Lambert SB, Wu G, Brennan DC, Storch GA, Sloots TP, Wang D. Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 2007;3:e64.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  12. Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319:1096–100.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB. Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe. 2010;7:509–15.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. van der Meijden E, Janssens RW, Lauber C, Bouwes Bavinck JN, Gorbalenya AE, Feltkamp MC. Discovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog. 2010;6:e1001024.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  15. Gheit T, Dutta S, Oliver J, Robitaille A, Hampras S, Combes JD, McKay-Chopin S, Le Calvez-Kelm F, Fenske N, Cherpelis B, et al. Isolation and characterization of a novel putative human polyomavirus. Virology. 2017;506:45–54.

    Article  CAS  PubMed  Google Scholar 

  16. Scuda N, Hofmann J, Calvignac-Spencer S, Ruprecht K, Liman P, Kühn J, Hengel H, Ehlers B. A novel human polyomavirus closely related to the african green monkey-derived lymphotropic polyomavirus. J Virol. 2011;85:4586–90.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Buck CB, Phan GQ, Raiji MT, Murphy PM, McDermott DH, McBride AA. Complete genome sequence of a tenth human polyomavirus. J Virol. 2012;86:10887.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Lim ES, Reyes A, Antonio M, Saha D, Ikumapayi UN, Adeyemi M, Stine OC, Skelton R, Brennan DC, Mkakosya RS, et al. Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing. Virology. 2013;436:295–303.

    Article  CAS  PubMed  Google Scholar 

  19. Ondov BD, Starrett GJ, Sappington A, Kostic A, Koren S, Buck CB, Phillippy AM. Mash Screen: high-throughput sequence containment estimation for genome discovery. Genome Biol. 2019;20:232.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Korup S, Rietscher J, Calvignac-Spencer S, Trusch F, Hofmann J, Moens U, Sauer I, Voigt S, Schmuck R, Ehlers B. Identification of a novel human polyomavirus in organs of the gastrointestinal tract. PLoS ONE. 2013;8:e58021.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Mishra N, Pereira M, Rhodes RH, An P, Pipas JM, Jain K, Kapoor A, Briese T, Faust PL, Lipkin WI. Identification of a novel polyomavirus in a pancreatic transplant recipient with retinal blindness and vasculitic myopathy. J Infect Dis. 2014;210:1595–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Doerries K. Human polyomavirus JC and BK persistent infection. Adv Exp Med Biol. 2006;577:102–16.

    Article  CAS  PubMed  Google Scholar 

  23. Imperiale MJ, Jiang M. Polyomavirus persistence. Annu Rev Virol. 2016;3:517–32.

    Article  CAS  PubMed  Google Scholar 

  24. Leung AY, Yuen KY, Kwong YL. Polyoma BK virus and haemorrhagic cystitis in haematopoietic stem cell transplantation: a changing paradigm. Bone Marrow Transplant. 2005;36:929–37.

    Article  CAS  PubMed  Google Scholar 

  25. Ramos E, Drachenberg CB, Wali R, Hirsch HH. The decade of polyomavirus BK-associated nephropathy: state of affairs. Transplantation. 2009;87:621–30.

    Article  PubMed  Google Scholar 

  26. Yang D, Keys B, Conti D, Foulke L, Stellrecht K, Cook L, Lopez-Soler RI. JC polyomavirus nephropathy, a rare cause of transplant dysfunction: case report and review of literature. Transpl Infect Dis. 2017;19(2):12654.

    Article  Google Scholar 

  27. Atkinson AL, Atwood WJ. Fifty years of JC polyomavirus: a brief overview and remaining questions. Viruses. 2020;12:969.

    Article  CAS  PubMed Central  Google Scholar 

  28. Cortese I, Reich DS, Nath A. Progressive multifocal leukoencephalopathy and the spectrum of JC virus-related disease. Nat Rev Neurol. 2020;17(1):37–51.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Kazem S, van der Meijden E, Feltkamp MC. The trichodysplasia spinulosa-associated polyomavirus: virological background and clinical implications. APMIS. 2013;121:770–2.

    Article  CAS  PubMed  Google Scholar 

  30. Nicol JT, Robinot R, Carpentier A, Carandina G, Mazzoni E, Tognon M, Touzé A, Coursaget P. Age-specific seroprevalences of merkel cell polyomavirus, human polyomaviruses 6, 7, and 9, and trichodysplasia spinulosa-associated polyomavirus. Clin Vaccine Immunol. 2013;20:363–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. van der Meijden E, Bialasiewicz S, Rockett RJ, Tozer SJ, Sloots TP, Feltkamp MC. Different serologic behavior of MCPyV, TSPyV, HPyV6, HPyV7 and HPyV9 polyomaviruses found on the skin. PLoS ONE. 2013;8:e81078.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Robles C, Casabonne D, Benavente Y, Costas L, Gonzalez-Barca E, Aymerich M, Campo E, Tardon A, Jiménez-Moleón JJ, Castaño-Vinyals G, et al. Seroreactivity against Merkel cell polyomavirus and other polyomaviruses in chronic lymphocytic leukaemia, the MCC-Spain study. J Gen Virol. 2015;96:2286–92.

    Article  CAS  PubMed  Google Scholar 

  33. Gossai A, Waterboer T, Nelson HH, Michel A, Willhauck-Fleckenstein M, Farzan SF, Hoen AG, Christensen BC, Kelsey KT, Marsit CJ, et al. Seroepidemiology of human polyomaviruses in a US population. Am J Epidemiol. 2016;183:61–9.

    Article  PubMed  Google Scholar 

  34. Kamminga S, van der Meijden E, Feltkamp MCW, Zaaijer HL. Seroprevalence of fourteen human polyomaviruses determined in blood donors. PLoS ONE. 2018;13:e0206273.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  35. Foulongne V, Sauvage V, Hebert C, Dereure O, Cheval J, Gouilh MA, Pariente K, Segondy M, Burguière A, Manuguerra JC, et al. Human skin microbiota: high diversity of DNA viruses identified on the human skin by high throughput sequencing. PLoS ONE. 2012;7:e38499.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Wieland U, Silling S, Hellmich M, Potthoff A, Pfister H, Kreuter A. Human polyomaviruses 6, 7, 9, 10 and Trichodysplasia spinulosa-associated polyomavirus in HIV-infected men. J Gen Virol. 2014;95:928–32.

    Article  CAS  PubMed  Google Scholar 

  37. Wylie KM, Mihindukulasuriya KA, Zhou Y, Sodergren E, Storch GA, Weinstock GM. Metagenomic analysis of double-stranded DNA viruses in healthy adults. BMC Biol. 2014;12:71.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  38. Hampras SS, Giuliano AR, Lin HY, Fisher KJ, Abrahamsen ME, McKay-Chopin S, Gheit T, Tommasino M, Rollison DE. Natural history of polyomaviruses in men: the HPV infection in men (HIM) study. J Infect Dis. 2015;211:1437–46.

    Article  CAS  PubMed  Google Scholar 

  39. Fava P, Merlino C, Novelli M, Ponti R, Galliano I, Montanari P, Tovo PA, Fierro MT, Bergallo M. HPyV6, HPyV7 and TSPyV DNA sequences detection in skin disease patients and healthy subjects. J Eur Acad Dermatol Venereol. 2016;30:624–7.

    Article  CAS  PubMed  Google Scholar 

  40. Franzén J, Ramqvist T, Bogdanovic G, Grün N, Mattson J, Dalianis T. Studies of human polyomaviruses, with HPyV7, BKPyV, and JCPyV present in urine of allogeneic hematopoietic stem cell transplanted patients with or without hemorrhagic cystitis. Transpl Infect Dis. 2016;18:240–6.

    Article  PubMed  CAS  Google Scholar 

  41. Siebrasse EA, Bauer I, Holtz LR, Le BM, Lassa-Claxton S, Canter C, Hmiel P, Shenoy S, Sweet S, Turmelle Y, et al. Human polyomaviruses in children undergoing transplantation, United States, 2008–2010. Emerg Infect Dis. 2012;18:1676–9.

    Article  PubMed  PubMed Central  Google Scholar 

  42. Delbue S, Franciotta D, Giannella S, Dolci M, Signorini L, Ticozzi R, D’Alessandro S, Campisciano G, Comar M, Ferrante P, et al. Human polyomaviruses in the cerebrospinal fluid of neurological patients. Microorganisms. 2019;8:16.

    Article  PubMed Central  CAS  Google Scholar 

  43. Delbue S, Elia F, Signorini L, Bella R, Villani S, Marchioni E, Ferrante P, Phan TG, Delwart E. Human polyomavirus 6 DNA in the cerebrospinal fluid of an HIV-positive patient with leukoencephalopathy. J Clin Virol. 2015;68:24–7.

    Article  CAS  PubMed  Google Scholar 

  44. Fukumoto H, Sato Y, Hasegawa H, Katano H. Frequent detection of Merkel cell polyomavirus DNA in sera of HIV-1-positive patients. Virol J. 2013;10:84.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Zheng WZ, Wei TL, Ma FL, Yuan WM, Zhang Q, Zhang YX, Cui H, Zheng LS. Human polyomavirus type six in respiratory samples from hospitalized children with respiratory tract infections in Beijing, China. Virol J. 2015;12:166.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  46. Rascovan N, Monteil Bouchard S, Grob JJ, Collet-Villette AM, Gaudy-Marqueste C, Penicaud M, Lepidi H, Raoult D, Desnues C. Human polyomavirus-6 infecting lymph nodes of a patient with an angiolymphoid hyperplasia with eosinophilia or Kimura disease. Clin Infect Dis. 2016;62:1419–21.

    Article  CAS  PubMed  Google Scholar 

  47. Aboudar S, Salmona M, De Masson A, Rivet J, Cardot-Leccia N, Mercier-Delarue S, Ram-Wolff C, Garnier G, Bouaziz JD, Lebbé C, et al. Diversity and compartmentalization of human polyomavirus 7 in a patient with dyskeratotic dermatosis. J Eur Acad Dermatol Venereol. 2020;34:e609–12.

    Article  CAS  PubMed  Google Scholar 

  48. Kolia-Diafouka P, Foulongne V, Boulle N, Ngou J, Kelly H, Sawadogo B, Delany-Moretlwe S, Mayaud P, Segondy M. Detection of four human polyomaviruses (MCPyV, HPyV6, HPyV7 and TSPyV) in cervical specimens from HIV-infected and HIV-uninfected women. Sex Transm Infect. 2016;92:492–4.

    Article  PubMed  Google Scholar 

  49. Ho J, Jedrych JJ, Feng H, Natalie AA, Grandinetti L, Mirvish E, Crespo MM, Yadav D, Fasanella KE, Proksell S, et al. Human polyomavirus 7-associated pruritic rash and viremia in transplant recipients. J Infect Dis. 2015;211:1560–5.

    Article  PubMed  Google Scholar 

  50. Nguyen KD, Lee EE, Yue Y, Stork J, Pock L, North JP, Vandergriff T, Cockerell C, Hosler GA, Pastrana DV, et al. Human polyomavirus 6 and 7 are associated with pruritic and dyskeratotic dermatoses. J Am Acad Dermatol. 2017;76:932–40.

    Article  CAS  PubMed  Google Scholar 

  51. Canavan TN, Baddley JW, Pavlidakey P, Tallaj JA, Elewski BE. Human polyomavirus-7-associated eruption successfully treated with acitretin. Am J Transplant. 2018;18:1278–84.

    Article  CAS  PubMed  Google Scholar 

  52. Smith SDB, Erdag G, Cuda JD, Rangwala S, Girardi N, Bibee K, Orens JB, Prono MD, Toptan T, Loss MJ. Treatment of human polyomavirus-7-associated rash and pruritus with topical cidofovir in a lung transplant patient: case report and literature review. Transpl Infect Dis. 2018;20(1):e12793.

    Article  Google Scholar 

  53. Rosenstein RK, Pastrana DV, Starrett GJ, Sapio MR, Hill NT, Jo JH, Lee CR, Iadarola MJ, Buck CB, Kong HH et al. Host-pathogen interactions in human polyomavirus 7 (HPyV7)-associated pruritic skin eruption. J Investig Dermatol. 2020;S0022–202x(20)32145-X.

  54. Hashida Y, Higuchi T, Nakajima S, Nakajima K, Ujihara T, Kabashima K, Sano S, Daibata M. Human polyomavirus 6 detected in cases of eosinophilic pustular folliculitis. J Infect Dis. 2020;jiaaa607.

  55. Hashida Y, Higuchi T, Nakajima K, Ujihara T, Murakami I, Fujieda M, Sano S, Daibata M. Human polyomavirus 6 with the Asian-Japanese genotype in cases of kimura disease and angiolymphoid hyperplasia with eosinophilia. J Investig Dermatol. 2020;140:1650–3.

    Article  CAS  PubMed  Google Scholar 

  56. Zanotta N, Delbue S, Signorini L, Villani S, D’Alessandro S, Campisciano G, Colli C, De Seta F, Ferrante P, Comar M. Merkel cell polyomavirus is associated with anal infections in men who have sex with men. Microorganisms. 2019;7:54.

    Article  CAS  PubMed Central  Google Scholar 

  57. Schrama D, Buck CB, Houben R, Becker JC. No evidence for association of HPyV6 or HPyV7 with different skin cancers. J Investig Dermatol. 2012;132:239–41.

    Article  CAS  PubMed  Google Scholar 

  58. Scola N, Wieland U, Silling S, Altmeyer P, Stücker M, Kreuter A. Prevalence of human polyomaviruses in common and rare types of non-Merkel cell carcinoma skin cancer. Br J Dermatol. 2012;167:1315–20.

    Article  CAS  PubMed  Google Scholar 

  59. Imajoh M, Hashida Y, Nakajima H, Sano S, Daibata M. Prevalence and viral DNA loads of three novel human polyomaviruses in skin cancers from Japanese patients. J Dermatol. 2013;40:657–60.

    Article  CAS  PubMed  Google Scholar 

  60. Schrama D, Groesser L, Ugurel S, Hafner C, Pastrana DV, Buck CB, Cerroni L, Theiler A, Becker JC. Presence of human polyomavirus 6 in mutation-specific BRAF inhibitor-induced epithelial proliferations. JAMA Dermatol. 2014;150:1180–6.

    Article  PubMed  PubMed Central  Google Scholar 

  61. Frouin E, Guillot B, Larrieux M, Tempier A, Boulle N, Foulongne V, Girard C, Costes V, Solassol J. Cutaneous epithelial tumors induced by vemurafenib involve the MAPK and Pi3KCA pathways but not HPV nor HPyV viral infection. PLoS ONE. 2014;9:e110478.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  62. Beckervordersandforth J, Pujari S, Rennspiess D, Speel EJ, Winnepenninckx V, Diaz C, Weyers W, Haugg AM, Kurz AK, Zur HA. Frequent detection of human polyomavirus 6 in keratoacanthomas. Diagn Pathol. 2016;11:58.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  63. Bergallo M, Daprà V, Fava P, Ponti R, Calvi C, Montanari P, Novelli M, Quaglino P, Galliano I, Fierro MT. DNA from human polyomaviruses, MWPyV, HPyV6, HPyV7, HPyV9 and HPyV12 in cutaneous T-cell lymphomas. Anticancer Res. 2018;38:4111–4.

    Article  CAS  PubMed  Google Scholar 

  64. Purdie KJ, Proby CM, Rizvi H, Griffin H, Doorbar J, Sommerlad M, Feltkamp MC, der Meijden EV, Inman GJ, South AP, et al. The role of human papillomaviruses and polyomaviruses in BRAF-inhibitor induced cutaneous squamous cell carcinoma and benign squamoproliferative lesions. Front Microbiol. 2018;9:1806.

    Article  PubMed  PubMed Central  Google Scholar 

  65. Antonsson A, Bialasiewicz S, Rockett RJ, Jacob K, Bennett IC, Sloots TP. Exploring the prevalence of ten polyomaviruses and two herpes viruses in breast cancer. PLoS ONE. 2012;7:e39842.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  66. Du-Thanh A, Guillot B, Dereure O, Foulongne V. Detection of Merkel cell and other human polyomavirus DNA in lesional and nonlesional skin from patients with Kaposi sarcoma. Br J Dermatol. 2015;173:1063–5.

    Article  CAS  PubMed  Google Scholar 

  67. Rennspiess D, Pujari S, Keijzers M, Abdul-Hamid MA, Hochstenbag M, Dingemans AM, Kurz AK, Speel EJ, Haugg A, Pastrana DV, et al. Detection of human polyomavirus 7 in human thymic epithelial tumors. J Thorac Oncol. 2015;10:360–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  68. Klufah F, Mobaraki G, Chteinberg E, Alharbi RA, Winnepenninckx V, Speel EJM, Rennspiess D, Olde Damink SW, Neumann UP, Kurz AK, et al. High prevalence of human polyomavirus 7 in cholangiocarcinomas and adjacent peritumoral hepatocytes: preliminary findings. Microorganisms. 2020;8:1125.

    Article  CAS  PubMed Central  Google Scholar 

  69. Chan JF, Tee KM, Choi GK, Zhu Z, Poon RW, Ng KT, Chan KH, Hung IF, Man K, Yuen KY. First detection and complete genome sequence of a phylogenetically distinct human polyomavirus 6 highly prevalent in human bile samples. J Infect. 2017;74:50–9.

    Article  PubMed  Google Scholar 

  70. Bendiksen S, Rekvig OP, Van Ghelue M, Moens U. VP1 DNA sequences of JC and BK viruses detected in urine of systemic lupus erythematosus patients reveal no differences from strains expressed in normal individuals. J Gen Virol. 2000;81:2625–33.

    Article  CAS  PubMed  Google Scholar 

  71. Taguchi F, Hara K, Kajioka J, Nagaki D. Isolation of BK virus from a patient with systemic lupus erythematosus (SLE). Microbiol Immunol. 1979;23:1131–2.

    Article  CAS  PubMed  Google Scholar 

  72. Chang D, Tsai RT, Wang M, Ou WC. Different genotypes of human polyomaviruses found in patients with autoimmune diseases in Taiwan. J Med Virol. 1996;48:204–9.

    Article  CAS  PubMed  Google Scholar 

  73. Rekvig OP, Moens U, Sundsfjord A, Bredholt G, Osei A, Haaheim H, Traavik T, Arnesen E, Haga HJ. Experimental expression in mice and spontaneous expression in human SLE of polyomavirus T-antigen. A molecular basis for induction of antibodies to DNA and eukaryotic transcription factors. J Clin Investig. 1997;99:2045–54.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  74. Sundsfjord A, Osei A, Rosenqvist H, Van Ghelue M, Silsand Y, Haga HJ, Rekvig OP, Moens U. BK and JC viruses in patients with systemic lupus erythematosus: prevalent and persistent BK viruria, sequence stability of the viral regulatory regions, and nondetectable viremia. J Infect Dis. 1999;180:1–9.

    Article  CAS  PubMed  Google Scholar 

  75. Colla L, Mesiano P, Morellini V, Besso L, Cavallo R, Bergallo M, Costa C, Merlino C, Marcuccio C, Fop F, et al. Human polyomavirus BK in patients with lupus nephritis: clinical and histological correlations. Lupus. 2007;16:881–6.

    Article  CAS  PubMed  Google Scholar 

  76. Stoner GL, Agostini HT, Ryschkewitsch CF, Komoly S. JC virus excreted by multiple sclerosis patients and paired controls from Hungary. Multiple Scler. 1998;4:45–8.

    Article  CAS  Google Scholar 

  77. Bellizzi A, Anzivino E, Rodio DM, Cioccolo S, Scrivo R, Morreale M, Pontecorvo S, Ferrari F, Di Nardo G, Nencioni L, et al. Human Polyomavirus JC monitoring and noncoding control region analysis in dynamic cohorts of individuals affected by immune-mediated diseases under treatment with biologics: an observational study. Virol J. 2013;10:298.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  78. Lonergan RM, Carr MJ, De Gascun CF, Costelloe LF, Waters A, Coughlan S, Duggan M, Doyle K, Jordan S, Hutchinson MW, et al. Reactivation of BK polyomavirus in patients with multiple sclerosis receiving natalizumab therapy. J Neurovirol. 2009;15:351–9.

    Article  CAS  PubMed  Google Scholar 

  79. Delbue S, Elia F, Carloni C, Pecchenini V, Franciotta D, Gastaldi M, Colombo E, Signorini L, Carluccio S, Bellizzi A, et al. JC virus urinary excretion and seroprevalence in natalizumab-treated multiple sclerosis patients. J Neurovirol. 2015;21:645–52.

    Article  CAS  PubMed  Google Scholar 

  80. Pietropaolo V, Bellizzi A, Anzivino E, Iannetta M, Zingaropoli MA, Rodio DM, Morreale M, Pontecorvo S, Francia A, Vullo V, et al. Human polyomavirus JC replication and non-coding control region analysis in multiple sclerosis patients under natalizumab treatment. J Neurovirol. 2015;21:653–65.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  81. Nali LH, Fink MC, do Olival GS, Moraes L, Callegaro D, Tilbery CP, Vidal JE, Sumita LM, de Oliveira AC, Romano CM. Polyomavirus detection in multiple sclerosis patients under natalizumab therapy: profile and frequency of urinary shedding. J Med Virol. 2017;89:528–34.

    Article  CAS  PubMed  Google Scholar 

  82. Dolci M, Favero C, Bollati V, Campo L, Cattaneo A, Bonzini M, Villani S, Ticozzi R, Ferrante P, Delbue S. Particulate matter exposure increases JC polyomavirus replication in the human host. Environ Pollut. 2018;241:234–9.

    Article  CAS  PubMed  Google Scholar 

  83. Rockett RJ, Sloots TP, Bowes S, O’Neill N, Ye S, Robson J, Whiley DM, Lambert SB, Wang D, Nissen MD, et al. Detection of novel polyomaviruses, TSPyV, HPyV6, HPyV7, HPyV9 and MWPyV in feces, urine, blood, respiratory swabs and cerebrospinal fluid. PLoS ONE. 2013;8:e62764.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  84. Torres C, Barrios ME, Cammarata RV, Cisterna DM, Estrada T, Martini Novas S, Cahn P, Blanco Fernández MD, Mbayed VA. High diversity of human polyomaviruses in environmental and clinical samples in Argentina: detection of JC, BK, Merkel-cell, Malawi, and human 6 and 7 polyomaviruses. Sci Total Environ. 2016;542:192–202.

    Article  CAS  PubMed  Google Scholar 

  85. Hashida Y, Higuchi T, Tanaka M, Shibata Y, Nakajima K, Sano S, Daibata M. Prevalence and viral loads of cutaneous human polyomaviruses in the skin of patients with chronic inflammatory skin diseases. J Infect Dis. 2019;219:1564–73.

    Article  CAS  PubMed  Google Scholar 

  86. Markowitz RB, Eaton BA, Kubik MF, Latorra D, McGregor JA, Dynan WS. BK virus and JC virus shed during pregnancy have predominantly archetypal regulatory regions. J Virol. 1991;65:4515–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  87. Chang D, Wang M, Ou WC, Lee MS, Ho HN, Tsai RT. Genotypes of human polyomaviruses in urine samples of pregnant women in Taiwan. J Med Virol. 1996;48:95–101.

    Article  CAS  PubMed  Google Scholar 

  88. Boldorini R, Veggiani C, Amoruso E, Allegrini S, Miglio U, Paganotti A, Ribaldone R, Monga G. Latent human polyomavirus infection in pregnancy: investigation of possible transplacental transmission. Pathology. 2008;40:72–7.

    Article  PubMed  Google Scholar 

  89. Kling CL, Wright AT, Katz SE, McClure GB, Gardner JS, Williams JT, Meinerz NM, Garcea RL, Vanchiere JA. Dynamics of urinary polyomavirus shedding in healthy adult women. J Med Virol. 2012;84:1459–63.

    Article  PubMed  PubMed Central  Google Scholar 

  90. Csoma E, Sápy T, Mészáros B, Gergely L. Novel human polyomaviruses in pregnancy: higher prevalence of BKPyV, but no WUPyV, KIPyV and HPyV9. J Clin Virol. 2012;55:262–5.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

The APC was funded by UiT, The Arctic University of Norway.

Funding

This work was supported by the Aakre Foundation (A65285;UM) and Carla Prezioso was supported by the Italian Ministry of Health (starting Grant: SG-2018-12366194).

Author information

Authors and Affiliations

  1. Department of Public Health and Infectious Diseases, “Sapienza” University of Rome, Rome, Italy

    Carla Prezioso & Valeria Pietropaolo

  2. Microbiology of Chronic Neuro-Degenerative Pathologies, IRCSS San Raffaele Pisana, Rome, Italy

    Carla Prezioso

  3. Department of Medical Genetics, Division of Child and Adolescent Health, University Hospital of North Norway, Tromsø, Norway

    Marijke Van Ghelue

  4. Department of Clinical Medicine Faculty of Health Sciences, University of Tromsø - The Arctic University of Norway, Tromsø, Norway

    Marijke Van Ghelue

  5. Department of Medical Biology, Faculty of Health Sciences, University of Tromsø - The Arctic University of Norway, Tromsø, Norway

    Ugo Moens

Authors
  1. Carla Prezioso
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Marijke Van Ghelue
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Ugo Moens
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Valeria Pietropaolo
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization: UM and VP; methodology: CP, MVG, UM, VP, experiments: CP, MVG, UM; validation and formal analysis: CP, MVG, UM, VP; original draft preparation: UM and VP; writing, reviewing and editing the manuscript: CP, MVG, UM and VP. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Ugo Moens or Valeria Pietropaolo.

Ethics declarations

Ethical approval and consent to participate

This study was approved by the Regional Committees for Medical and Health Research Ethics, University of Tromsø—The Arctic University of Norway (REK; reference number 2012/420).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Prezioso, C., Van Ghelue, M., Moens, U. et al. HPyV6 and HPyV7 in urine from immunocompromised patients. Virol J 18, 24 (2021). https://0-doi-org.brum.beds.ac.uk/10.1186/s12985-021-01496-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12985-021-01496-1

Keywords

Virology Journal

ISSN: 1743-422X