Table 1 The list of primers were designed by oligo 7 software and used in this study
From: Lineage analysis of human papillomavirus type 39 in cervical samples of Iranian women
Target gene | Name of primer | Sequence of primer (5′–3′) | Nucleotide position | Amplicon size (bp) | References |
|---|---|---|---|---|---|
E6 | 39-E6-F1 | AGTAACCGAAAACGGTCAGGA | 39–59 | 641 |  |
|  | 39-E6-R1 | TCGTGACATACAAGGTCAACCG | 659–680 |  | This study |
|  | 39-E6-F2 | CAGGACCGAAATCGGTGGAT | 55–74 | 616 |  |
|  | 39-E6-R2 | ACAAGGTCAACCGGCTGTAT | 652–671 |  |  |
LCR | 39-LCR-F1 | ACTATAGGTCCCCGAAAGCG | 7077–7096 | 752 |  |
|  | 39-LCR-R1 | AGTATAGGTATGTATGCCCAACC | 7807–7829 |  | This study |
|  | 39-LCR-F2 | ACTTCCTCGTCCTCAGCTACTA | 7110–7131 | 704 |  |
|  | 39-LCR-R2 | GCCCAACCTATTTCGGTTGCAT | 77,930–7814 |  |  |