Skip to main content
Fig. 4 | Virology Journal

Fig. 4

From: A ligation and restriction enzyme independent cloning technique: an alternative to conventional methods for cloning hard-to-clone gene segments in the influenza reverse genetics system

Fig. 4

The PB1 colonies of Jiangxi/2015 were screened by colony PCR. A portion of 550 bp of PB1 was amplified using the primers H5N6 PB1F (GAAGTTGGGGGGGAGCGAAAGCAGGC) and H5N6 PB1-R (CATCACATCCTTGAGGAAATCTATTAG). Eight colonies were screened by colony PCR. The positive colonies in colony PCR (indicated by arrows) were further confirmed by plasmid PCR and nucleotide sequencing using T7F and BGHR primers (+ = positive control; M = DNA marker)

Back to article page

Virology Journal

ISSN: 1743-422X